pDM4 Plasmid


  • Model: PVT6015
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pDM4,Plasmid pDM4,pDM4 vector


pDM4 Plasmid information

Replicon: R6K gamma ori, oriT
Classification: E. series plasmid plasmid; plasmid SacB plasmid Escherichia E. editing;
Plasmid size: 7104bp
Prokaryotic resistance: chloramphenicol Chl (50 g/ml)
Clone strain: S17-1, gamma PRI and other Escherichia coli
Culture conditions: 37, LB, aerobic
5'sequencing primer: Cat-R (GGTATTTATTCGGCGCAAAGTGC)
3'sequencing primer: Cat-F (GTGACAATCACGAAACGCGG)
Use:Homologous recombination HR plasmid


pDM4 Plasmid Sequence

LOCUS       Exported                7104 bp ds-DNA     circular SYN 27-JUN-2017
DEFINITION  synthetic circular DNA
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 7104)
  TITLE     Direct Submission
  JOURNAL   Exported Tuesday, June 27, 2017 

FEATURES             Location/Qualifiers
     source          1..7104
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     oriT            623..732
                     /note="incP origin of transfer"
     CDS             765..1136
                     /product="oriT-recognizing protein"
     rep_origin      1754..2142
                     /note="R6K gamma ori"
                     /note="gamma replication origin from E. coli plasmid R6K;
                     requires the R6K initiator protein pi for replication"
     protein_bind    2177..2193
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     misc_feature    2204..2313
     promoter        2574..2676
                     /note="cat promoter"
                     /note="promoter of the E. coli cat gene encoding
                     chloramphenicol acetyltransferase"
     CDS             2677..3336
                     /product="chloramphenicol acetyltransferase"
                     /note="confers resistance to chloramphenicol"
     promoter        3753..4198
                     /note="sacB promoter"
                     /note="sacB promoter and control region"
     CDS             4199..5620
                     /gene="Bacillus subtilis sacB"
                     /product="secreted levansucrase that renders bacterial
                     growth sensitive to sucrose"
                     /note="negative selection marker"
        1 gatccttttt gtccggtgtt gggttgaagg tgaagccggt cggggccgca gcgggggccg
       61 gcttttcagc cttgcccccc tgcttcggcc gccgtggctc cggcgtcttg ggtgccggcg
      121 cgggttccgc agccttggcc tgcggtgcgg gcacatcggc gggcttggcc ttgatgtgcc
      181 gcctggcgtg cgagcggaac gtctcgtagg agaacttgac cttccccgtt tcccgcatgt
      241 gctcccaaat ggtgacgagc gcatagccgg acgctaacgc cgcctcgaca tccgccctca
      301 ccgccaggaa cgcaaccgca gcctcatcac gccggcgctt cttggccgcg cgggattcaa
      361 cccactcggc cagctcgtcg gtgtagctct ttggcatcgt ctctcgcctg tcccctcagt
      421 tcagtaattt cctgcatttg cctgtttcca gtcggtagat attccacaaa acagcaggga
      481 agcagcgctt ttccgctgca taaccctgct tcggggtcat tatagcgatt ttttcggtat
      541 atccatcctt tttcgcacga tatacaggat tttgccaaag ggttcgtgta gactttcctt
      601 ggtgtatcca acggcgtcag ccgggcagga taggtgaagt aggcccaccc gcgagcgggt
      661 gttccttctt cactgtccct tattcgcacc tggcggtgct caacgggaat cctgctctgc
      721 gaggctggcc ggctaccgcc ggcgtaacag atgagggcaa gcggatggct gatgaaacca
      781 agccaaccag gaagggcagc ccacctatca aggtgtactg ccttccagac gaacgaagag
      841 cgattgagga aaaggcggcg gcggccggca tgagcctgtc ggcctacctg ctggccgtcg
      901 gccagggcta caaaatcacg ggcgtcgtgg actatgagca cgtccgcgag ctggcccgca
      961 tcaatggcga cctgggccgc ctgggcggcc tgctgaaact ctggctcacc gacgacccgc
     1021 gcacggcgcg gttcggtgat gccacgatcc tcgccctgct ggcgaagatc gaagagaagc
     1081 aggacgagct tggcaaggtc atgatgggcg tggtccgccc gagggcagag ccatgacttt
     1141 tttagccgct aaaacggccg gggggtgcgc gtgattgcca agcacgtccc catgcgctcc
     1201 atcaagaaga gcgacttcgc ggagctggtg aagtacatca ccgacgagca aggcaagacc
     1261 gagcgcctgg gtcacgtgcg cgtcacgaac tgcgaggcaa acaccctgcc cgctgtcatg
     1321 gccgaggtga tggcgaccca gcacggcaac acccgttccg aggccgacaa gacctatcac
     1381 ctgctggtta gcttccgcgc gggagagaag cccgacgcgg agacgttgcg cgcgattgag
     1441 gaccgcatct gcgctgggct tggcttcgcc gagcatcagc gcgtcagtgc cgtgcatcac
     1501 gacaccgaca acctgcacat ccatatcgcc atcaacaaga ttcacccgac ccgaaacacc
     1561 atccatgagc cgtatcgggc ctaccgcgcc ctcgctgacc tctgcgcgac gctcgaacgg
     1621 gactacgggc ttgagcgtga caatcacgaa acgcggcagc gcgtttccga gaaccgcgcg
     1681 aacgacatgg agcggcacgc gggcgtggaa agcctggtcg gctggatccg gccacgatgc
     1741 gtccggcgta gaggatctga agatcagcag ttcaacctgt tgatagtacg tactaagctc
     1801 tcatgtttca cgtactaagc tctcatgttt aacgtactaa gctctcatgt ttaacgaact
     1861 aaaccctcat ggctaacgta ctaagctctc atggctaacg tactaagctc tcatgtttca
     1921 cgtactaagc tctcatgttt gaacaataaa attaatataa atcagcaact taaatagcct
     1981 ctaaggtttt aagttttata agaaaaaaaa gaatatataa ggcttttaaa gcttttaagg
     2041 tttaacggtt gtggacaaca agccagggat gtaacgcact gagaagccct tagagcctct
     2101 caaagcaatt ttgagtgaca caggaacact taacggctga catgggaatt ccacatgtgg<

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
