pDM4 Plasmid


  • Model: PVT6015
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT6015  2ug

pDM4 Plasmid information

Replicon: R6K gamma ori, oriT
Classification: E. series plasmid plasmid; plasmid SacB plasmid Escherichia E. editing;
Plasmid size: 7104bp
Prokaryotic resistance: chloramphenicol Chl (50 g/ml)
Clone strain: S17-1, gamma PRI and other Escherichia coli
Culture conditions: 37, LB, aerobic
5'sequencing primer: Cat-R (GGTATTTATTCGGCGCAAAGTGC)
3'sequencing primer: Cat-F (GTGACAATCACGAAACGCGG)
Use:Homologous recombination HR plasmid


pDM4 Plasmid Sequence

LOCUS       Exported                7104 bp ds-DNA     circular SYN 27-JUN-2017
DEFINITION  synthetic circular DNA
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 7104)
  TITLE     Direct Submission
  JOURNAL   Exported Tuesday, June 27, 2017 
FEATURES             Location/Qualifiers
     source          1..7104
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     oriT            623..732
                     /note="incP origin of transfer"
     CDS             765..1136
                     /product="oriT-recognizing protein"
     rep_origin      1754..2142
                     /note="R6K gamma ori"
                     /note="gamma replication origin from E. coli plasmid R6K;
                     requires the R6K initiator protein pi for replication"
     protein_bind    2177..2193
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     misc_feature    2204..2313
     promoter        2574..2676
                     /note="cat promoter"
                     /note="promoter of the E. coli cat gene encoding
                     chloramphenicol acetyltransferase"
     CDS             2677..3336
                     /product="chloramphenicol acetyltransferase"
                     /note="confers resistance to chloramphenicol"
     promoter        3753..4198
                     /note="sacB promoter"
                     /note="sacB promoter and control region"
     CDS             4199..5620
                     /gene="Bacillus subtilis sacB"
                     /product="secreted levansucrase that renders bacterial
                     growth sensitive to sucrose"
                     /note="negative selection marker"
        1 gatccttttt gtccggtgtt gggttgaagg tgaagccggt cggggccgca gcgggggccg
       61 gcttttcagc cttgcccccc tgcttcggcc gccgtggctc cggcgtcttg ggtgccggcg
      121 cgggttccgc agccttggcc tgcggtgcgg gcacatcggc gggcttggcc ttgatgtgcc
      181 gcctggcgtg cgagcggaac gtctcgtagg agaacttgac cttccccgtt tcccgcatgt
      241 gctcccaaat ggtgacgagc gcatagccgg acgctaacgc cgcctcgaca tccgccctca
      301 ccgccaggaa cgcaaccgca gcctcatcac gccggcgctt cttggccgcg cgggattcaa
      361 cccactcggc cagctcgtcg gtgtagctct ttggcatcgt ctctcgcctg tcccctcagt
      421 tcagtaattt cctgcatttg cctgtttcca gtcggtagat attccacaaa acagcaggga
      481 agcagcgctt ttccgctgca taaccctgct tcggggtcat tatagcgatt ttttcggtat
      541 atccatcctt tttcgcacga tatacaggat tttgccaaag ggttcgtgta gactttcctt
      601 ggtgtatcca acggcgtcag ccgggcagga taggtgaagt aggcccaccc gcgagcgggt
      661 gttccttctt cactgtccct tattcgcacc tggcggtgct caacgggaat cctgctctgc
      721 gaggctggcc ggctaccgcc ggcgtaacag atgagggcaa gcggatggct gatgaaacca
      781 agccaaccag gaagggcagc ccacctatca aggtgtactg ccttccagac gaacgaagag
      841 cgattgagga aaaggcggcg gcggccggca tgagcctgtc ggcctacctg ctggccgtcg
      901 gccagggcta caaaatcacg ggcgtcgtgg actatgagca cgtccgcgag ctggcccgca
      961 tcaatggcga cctgggccgc ctgggcggcc tgctgaaact ctggctcacc gacgacccgc
     1021 gcacggcgcg gttcggtgat gccacgatcc tcgccctgct ggcgaagatc gaagagaagc
     1081 aggacgagct tggcaaggtc atgatgggcg tggtccgccc gagggcagag ccatgacttt
     1141 tttagccgct aaaacggccg gggggtgcgc gtgattgcca agcacgtccc catgcgctcc
     1201 atcaagaaga gcgacttcgc ggagctggtg aagtacatca ccgacgagca aggcaagacc
     1261 gagcgcctgg gtcacgtgcg cgtcacgaac tgcgaggcaa acaccctgcc cgctgtcatg
     1321 gccgaggtga tggcgaccca gcacggcaac acccgttccg aggccgacaa gacctatcac
     1381 ctgctggtta gcttccgcgc gggagagaag cccgacgcgg agacgttgcg cgcgattgag
     1441 gaccgcatct gcgctgggct tggcttcgcc gagcatcagc gcgtcagtgc cgtgcatcac
     1501 gacaccgaca acctgcacat ccatatcgcc atcaacaaga ttcacccgac ccgaaacacc
     1561 atccatgagc cgtatcgggc ctaccgcgcc ctcgctgacc tctgcgcgac gctcgaacgg
     1621 gactacgggc ttgagcgtga caatcacgaa acgcggcagc gcgtttccga gaaccgcgcg
     1681 aacgacatgg agcggcacgc gggcgtggaa agcctggtcg gctggatccg gccacgatgc
     1741 gtccggcgta gaggatctga agatcagcag ttcaacctgt tgatagtacg tactaagctc
     1801 tcatgtttca cgtactaagc tctcatgttt aacgtactaa gctctcatgt ttaacgaact
     1861 aaaccctcat ggctaacgta ctaagctctc atggctaacg tactaagctc tcatgtttca
     1921 cgtactaagc tctcatgttt gaacaataaa attaatataa atcagcaact taaatagcct
     1981 ctaaggtttt aagttttata agaaaaaaaa gaatatataa ggcttttaaa gcttttaagg
     2041 tttaacggtt gtggacaaca agccagggat gtaacgcact gagaagccct tagagcctct
     2101 caaagcaatt ttgagtgaca caggaacact taacggctga catgggaatt ccacatgtgg
     2161 aattccacat gtggaattgt gagcggataa caatttgtgg aatcccggga gagctcaggt
     2221 tacccgcatg caagatctat ctagaagggc cccactagtg acgcgtactc gagggtcgac
     2281 ggtatcgata agcttgatat acactccgct agcgctgatg tccggcggtg cttttgccgt
     2341 tacgcaccac cccgtcagta gctgaacagg agggacagct gatagaaaca gaagccactg
     2401 gagcacctca aaaacaccat catacactaa atcagtaagt tggcagcatc acccgacgca
     2461 ctttgcgccg aataaatacc tgtgacggaa gatcacttcg cagaataaat aaatcctggt
     2521 gtccctgttg ataccgggaa gccctgggcc aacttttggc gaaaatgaga cgttgatcgg
     2581 cacgtaagag gttccaactt tcaccataat gaaataagat cactaccggg cgtatttttt
     2641 gagttatcga gattttcagg agctaargaa gctaaaatgg agaaaaaaat cactggatat
     2701 accaccgttg atatatccca atggcatcgt aaagaacatt ttgaggcatt tcagtcagtt
     2761 gctcaatgta cctataacca gaccgttcag ctggatatta cggccttttt aaagaccgta
     2821 aagaaaaata agcacaagtt ttatccggcc tttattcaca ttcttgcccg cctgatgaat
     2881 gctcatccgg aattccgtat ggcaatgaaa gacggtgagc tggtgatatg ggatagtgtt
     2941 cacccttgtt acaccgtttt ccatgagcaa actgaaacgt tttcatcgct ctggagtgaa
     3001 taccacgacg atttccggca gtttctacac atatattcgc aagatgtggc gtgttacggt
     3061 gaaaacctgg cctatttccc taaagggttt attgagaata tgtttttcgt ctcagccaat
     3121 ccctgggtga gtttcaccag ttttgattta aacgtggcca atatggacaa cttcttcgcc
     3181 cccgttttca ccatgggcaa atattatacg caaggcgaca aggtgctgat gccgctggcg
     3241 attcaggttc atcatgccgt ttgtgatggc ttccatgtcg gcagaatgct taatgaatta
     3301 caacagtact gcgatgagtg gcagggcggg gcgtaatttt tttaaggcag ttattggtgc
     3361 ccttaaacgc ctggttgcta cgcctgaata agtgataata agcggatgaa tggcagaaat
     3421 tcgaaagcaa attcgacccg gtcgtcggtt cagggcaggg tcgttaaata gccgcttatg
     3481 tctattgctg gtttaccggt ttattgacta ccggaagcag tgtgaccgtg tgcttctcaa
     3541 atgcctgagg ccagwttgct cagctctccc gtggaggtaa taattgacga tatgatcatt
     3601 tattctgcct cccagagcct gataaaaacg gttagcgctt cgttaataca gatgtaggtg
     3661 ttccacaggg tagccagcag catcctgcga tgcagatcat cgaattcctg cagccaagct
     3721 agacctaggc cttaagatcc tttttaaccc atcacatata cctgccgttc actattattt
     3781 agtgaaatga gatattatga tattttctga attgtgatta aaaaggcaac tttatgccca
     3841 tgcaacagaa actataaaaa atacagagaa tgaaaagaaa cagatagatt ttttagttct
     3901 ttaggcccgt agtctgcaaa tccttttatg attttctatc aaacaaaaga ggaaaataga
     3961 ccagttgcaa tccaaacgag agtctaatag aatgaggtcg aaaagtaaat cgcgcgggtt
     4021 tgttactgat aaagcaggca agacctaaaa tgtgtaaagg gcaaagtgta tactttggcg
     4081 tcacccctta catattttag gtcttttttt attgtgcgta actaacttgc catcttcaaa
     4141 caggagggct ggaagaagca gaccgctaac acagtacata aaaaaggaga catgaacgat
     4201 gaacatcaaa aagtttgcaa aacaagcaac agtattaacc tttactaccg cactgctggc
     4261 aggaggcgca actcaagcgt ttgcgaaaga aacgaaccaa aagccatata aggaaacata
     4321 cggcatttcc catattacac gccatgatat gctgcaaatc cctgaacagc aaaaaaatga
     4381 aaaatatcaa gttcctgaat tcgattcgtc cacaattaaa aatatctctt ctgcaaaagg
     4441 cctggacgtt tgggacagct ggccattaca aaacgctgac ggcactgtcg caaactatca
     4501 cggctaccac atcgtctttg cattagccgg agatcctaaa aatgcggatg acacatcgat
     4561 ttacatgttc tatcaaaaag tcggcgaaac ttctattgac agctggaaaa acgctggccg
     4621 cgtctttaaa gacagcgaca aattcgatgc aaatgattct atcctaaaag accaaacaca
     4681 agaatggtca ggttcagcca catttacatc tgacggaaaa atccgtttat tctacactga
     4741 tttctccggt aaacattacg gcaaacaaac actgacaact gcacaagtta acgtatcagc
     4801 atcagacagc tctttgaaca tcaacggtgt agaggattat aaatcaatct ttgacggtga
     4861 cggaaaaacg tatcaaaatg tacagcagtt catcgatgaa ggcaactaca gctcaggcga
     4921 caaccatacg ctgagagatc ctcactacgt agaagataaa ggccacaaat acttagtatt
     4981 tgaagcaaac actggaactg aagatggcta ccaaggcgaa gaatctttat ttaacaaagc
     5041 atactatggc aaaagcacat cattcttccg tcaagaaagt caaaaacttc tgcaaagcga
     5101 taaaaaacgc acggctgagt tagcaaacgg cgctctcggt atgattgagc taaacgatga
     5161 ttacacactg aaaaaagtga tgaaaccgct gattgcatct aacacagtaa cagatgaaat
     5221 tgaacgcgcg aacgtcttta aaatgaacgg caaatggtac ctgttcactg actcccgcgg
     5281 atcaaaaatg acgattgacg gcattacgtc taacgatatt tacatgcttg gttatgtttc
     5341 taattcttta actggcccat acaagccgct gaacaaaact ggccttgtgt taaaaatgga
     5401 tcttgatcct aacgatgtaa cctttactta ctcacacttc gctgtacctc aagcgaaagg
     5461 aaacaatgtc gtgattacaa gctatatgac aaacagagga ttctacgcag acaaacaatc
     5521 aacgtttgcg ccaagcttcc tgctgaacat caaaggcaag aaaacatctg ttgtcaaaga
     5581 cagcatcctt gaacaaggac aattaacagt taacaaataa aaacgcaaaa gaaaatgccg
     5641 atatcctatt ggcattttct tttatttctt atcaacataa aggtgaatcc catatgaact
     5701 atataaaagc aggcaaatgg ctaaccgtat tcctaacctt ttggtaatga ctccaactta
     5761 ttgatagtgt tttatgttca gataatgccc gatgactttg tcatgcagct ccaccgattt
     5821 tgagaacgac agcgacttcc gtcccagccg tgccaggtgc tgcctcagat tcaggttatg
     5881 ccgctcaatt cgctgcgtat atcgcttgct gattacgtgc agctttccct tcaggcggga
     5941 ttcatacagc ggccagccat ccgtcatcca tatcaccacg tcaaagggtg acagcaggct
     6001 cataagacgc cccagcgtcg ccatagtgcg ttcaccgaat acgtgcgcaa caaccgtctt
     6061 ccggagactg tcatacgcgt aaaacagcca gcgctggcgc gatttagccc cgacatagcc
     6121 ccactgttcg tccatttccg cgcagacgat gacgtcactg cccggctgta tgcgcgaggt
     6181 taccgactgc ggcctgagtt ttttaagtga cgtaaaatcg tgttgaggcc aacgcccata
     6241 atgcgggctg ttgcccggca tccaacgcca ttcatggcca tatcaatgat tttctggtgc
     6301 gtaccgggtt gagaagcggt gtaagtgaac tgcagcaatg gcaacaacgt tgcgcaaact
     6361 attaactggc gaactactta ctctagcttc ccggcaacaa ttaatagact ggatggaggc
     6421 ggataaagtt gcaggaccac ttctgcgctc ggcccttccg gctggctggt ttattgctga
     6481 taaatctgga gccggtgagc gtgggtctcg cggtatcatt gcagcactgg ggccagatgg
     6541 taagccctcc cgtatcgtag ttatctacac gacggggagt caggcaacta tggatgaacg
     6601 aaatagacag atcgctgaga taggtgcctc actgattaag cattggtaac tgtcagacca
     6661 agtttactca tatatacttt agattgattt atggtgcact ctcagtacaa tctgctctga
     6721 tgccgcatag ttaagccagt atacactccg ctatcgctac gtgactgggt catggctgcg
     6781 ccccgacacc cgccaacacc cgctgacgcg ccctgacggg cttgtctgct cccggcatcc
     6841 gcttacagac aagctgtgac cgtctccggg agctgcatgt gtcagaggtt ttcaccgtca
     6901 tcaccgaaac gcgcgaggca gcaaggagat ggcgcccaac agtcccccgg ccacggggcc
     6961 tgccaccata cccacgccga aacaagcgct catgagcccg aagtggcgag cccgatcttc
     7021 cccatcggtg atgtcggcga tataggcgcc agcaaccgca cctgtggcgc cggtgatgcc
     7081 ggccacgatg cgtccggcgt agag



Product is for research use only!

Search name

pDM4,Plasmid pDM4,pDM4 vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
