pDSK-GFPuv Plasmid

$260.00

  • Model: PVT17263
  • 20 Units in Stock
Ask a question


Add to Cart:

pDSK-GFPuv Plasmid

PVT17263   2ug

 

pDSK-GFPuv Plasmid Alternative Name
pDSK-GFPuv Plasmid, pDSK-GFPuv Vector, pDSK-GFPuv, pDSK-GFPuv sequence, pDSK-GFPuv map, pDSK-GFPuv resistance

 

pDSK-GFPuv Plasmid Information

Promoter

Prokaryotic resistance Kan

Screening marker

Clone strain DH5a

Culture Conditions LB/37 Celsius degree

Forward primer

Reverse primer

 

pDSK-GFPuv Plasmid Description

pDSK-GFPuv Plasmid is a resistance Kan plasmid and size is 9770bp.

 

pDSK-GFPuv Plasmid Sequence

TATCGCGAGCCCATTTATACCCATATAAATCAGCATCCATGTTGGAATTTAATCGCGGCCTCGAGCAAGACGTTTCCCGT
TGAATATGGCTCATAACACCCCTTGTATTACTGTTTATGTAAGCAGACAGTTTTATTGTTCATGATGATATATTTTTATC
TTGTGCAATGTAACATCAGAGATTTTGAGACACAACGTGGCTTTGTTGAATAAATCGAACTTTTGCTGAGTTGAAGGATC
AGATCACGCATCTTCCCGACAACGCAGACCGTTCCGTGGCAAAGCAAAAGTTCAAAATCACCAACTGGTCCACCTACAAC
AAAGCTCTCATCAACCGTGGCTCCCTCACTTTCTGGCTGGATGATGGGGCGATTCAGGCCTGGTATGAGTCAGCAACACC
TTCTTCACGAGGCAGACCTCAGCGCTATTCTGACCTTGCCATCACGACTGTGCTGGTCATTAAACGCGTATTCAGGCTGA
CCCTGCGCGCTGCGCAGGGCTTTATTGATTCCATTTTTACACTGATGAATGTTCCGTTGCGCTGCCCGGATTACAGCTGC
GTTTCCTGTTTGGGGTCGTTTGCGGGAAGGGGCGGAATCCTACGCTAAGGCTTTGGCCAGCGATATTCTCCGGTGAGATT
GATGTGTTCCCAGGGGATAGGAGAAGTCGCTTGATATCTAGTATGACGTCTGTCGCACCTGCTTGATCGCGGCCGCGATA
GCTAGATCGCGTTGCTCCTCTTCTCCATCCGCGTTCCAAGCTGCGGAAAGGCACCCATAAGCGTACGCCTGGTCGAGCAG
GCGACGCGGATCGACGTCCAGCGCACGAGAGAATGCGTCCGCCATCTGTGCAATGCGTCTAGGATCGAGACAAAGGTCGT
CTCTGTCAGCCGGATCGTAGAACATATTGGCGGCGCCAAAGCCCACTTCACCGACCAGACATTCGCCATTCAGGCTGCGC
AACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATT
AAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTCGAGCTCGGTACCCGGGGAT
CTAGAGGATCTCAATGAATATTGGTTGACACGGGCGTATAAGACATGTTATACTGTTGAATAACAAGCTTTCAATTCTCT
ATTTTGAGAAGAATTAATGTGCTTGGGAGTCCCTGATGATTAAATTAAATAAACCAAGATTTTACCATGACTGCAATTTT
AGAGAGACGGGGGATCGATCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGAGTAAAGGAGAAGA
ACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGG
GTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACA
CTTGTCACTACTTTCTCTTATGGTGTTCAATGCTTTTCCCGTTATCCGGATCATATGAAACGGCATGACTTTTTCAAGAG
TGCCATGCCCGAAGGTTATGTACAGGAACGCACTATATCTTTCAAAGATGACGGGAACTACAAGACGCGTGCTGAAGTCA
AGTTTGAAGGTGATACCCTTGTTAATCGTATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTCGGACAC
AAACTCGAGTACAACTATAACTCACACAATGTATACATCACGGCAGACAAACAAAAGAATGGAATCAAAGCTAACTTCAA
AATTCGCCACAACATTGAAGATGGATCAGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTG
TCCTTTTACCAGACAACCATTACCTGTCGACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGCGTGACCACATGGTC
CTTCTTGAGTTTGTAACTGCTGCTGGGATTACACATGGCATGGATGAGCTCTACAAATAAGGATCCTCTAGAGTCGACCT
GCAGGCATGCAAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAAC
ATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACT
GCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTA
TTGGGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGG
AGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGA
TGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTT
TGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTC
GCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAAGAAGAGCATACATCTGGAAGCAAAGCCAG
GAAAGCGGCCTATGGAGCTGTGCGGCAGCGCTCAGTAGGCAATTTTTCAAAATATTGTTAAGCCTTTTCTGAGCATGGTA
TTTTTCATGGTATTACCAATTAGCAGGAAAATAAGCCATTGAATATAAAAGATAAAAATGTCTTGTTTACAATAGAGTGG
GGGGGGTCAGCCTGCCGCCTTGGGCCGGGTGATGTCGTACTTGCCCGCCGCGAACTCGGTTACCGTCCAGCCCAGCGCGA
CCAGCTCCGGCAACGCCTCGCGCACCCGCTGGCGGCGCTTGCGCATGGTCGAACCACTGGCCTCTGACGGCCAGACATAG
CCGCACAAGGTATCTATGGAAGCCTTGCCGGTTTTGCCGGGGTCGATCCAGCCACACAGCCGCTGGTGCAGCAGGCGGGC
GGTTTCGCTGTCCAGCGCCCGCACCTCGTCCATGCTGATGCGCACATGCTGGCCGCCACCCATGACGGCCTGCGCGATCA
AGGGGTTCAGGGCCACGTACAGGCGCCCGTCCGCCTCGTCGCTGGCGTACTCCGACAGCAGCCGAAACCCCTGCCGCTTG
CGGCCATTCTGGGCGATGATGGATACCTTCCAAAGGCGCTCGATGCAGTCCTGTATGTGCTTGAGCGCCCCACCACTATC
GACCTCTGCCCCGATTTCCTTTGCCAGCGCCCGATAGCTACCTTTGACCACCATGGCATCAGCGGTGACGGCCTCCCACT
TGGGTTCCAGGAACAGCCGGAGCTGCCGTCCGCCTTCGGTCTTGGGTTCCGGGCCAAGCACTAGGCCATTAGGCCCAGCC
ATGGCCACCAGCCCTTGCAGGATGCGCAGATCATCAGCGCCCAGCGGCTCCGGGCCGCTGAACTCGATCCGCTTGCCGTC
GCCGTAGTCATACGTCACGTCCAGCTTGCTGCGCTTGCGCTCGCCCCGCTTGAGGGCACGGAACAGGCCGGGGGCCAGAC
AGTGCGCCGGGTCGTGCCGGACGTGGCTGAGGCTGTGCTTGTTCTTAGGCTTCACCACGGGGCACCCCCTTGCTCTTGCG
CTGCCTCTCCAGCACGGCGGGCTTGAGCACCCCGCCGTCATGCCGCCTGAACCACCGATCAGCGAACGGTGCGCCATAGT
TGGCCTTGCTCACACCGAAGCGGACGAAGAACCGGCGCTGGTCGTCGTCCACACCCCATTCCTCGGCCTCGGCGCTGGTC
ATGCTCGACAGGTAGGACTGCCAGCGGATGTTATCGACCAGTACCGAGCTGCCCCGGCTGGCCTGCTGCTGGTCGCCTGC
GCCCATCATGGCCGCGCCCTTGCTGGCATGGTGCAGGAACACGATAGAGCACCCGGTATCGGCGGCGATGGCCTCCATGC
GACCGATGACCTGGGCCATGGGGCCGCTGGCGTTTTCTTCCTCGATGTGGAACCGGCGCAGCGTGTCCAGCACCATCAGG
CGGCGGCCCTCGGCGGCGCGCTTGAGGCCGTCGAACCACTCCGGGGCCATGATGTTGGGCAGGCTGCCGATCAGCGGCTG
GATCAGCAGGCCGTCAGCCACGGCTTGCCGTTCCTCGGCGCTGAGGTGCGCCCCAAGGGCGTGCAGGCGGTGATGAATGG
CGGTGGGCGGGTCTTCGGCGGGCAGGTAGATCACCGGGCCGGTGGGCAGTTCGCCCACCTCCAGCAGATCCGGCCCGCCT
GCAATCTGTGCGGCCAGTTGCAGGGCCAGCATGGATTTACCGGCACCACCGGGCGACACCAGCGCCCCGACCGTACCGGC
CACCATGTTGGGCAAAACGTAGTCCAGCGGTGGCGGCGCTGCTGCGAACGCCTCCAGAATATTGATAGGCTTATGGGTAG
CCATTGATTGCCTCCTTTGCAGGCAGTTGGTGGTTAGGCGCTGGCGGGGTCACTACCCCCGCCCTGCGCCGCTCTGAGTT
CTTCCAGGCACTCGCGCAGCGCCTCGTATTCGTCGTCGGTCAGCCAGAACTTGCGCTGACGCATCCCTTTGGCCTTCATG
CGCTCGGCATATCGCGCTTGGCGTACAGCGTCAGGGCTGGCCAGCAGGTCGCCGGTCTGCTTGTCCTTTTGGTCTTTCAT
ATCAGTCACCGAGAAACTTGCCGGGGCCGAAAGGCTTGTCTTCGCGGAACAAGGACAAGGTGCAGCCGTCAAGGTTAAGG
CTGGCCATATCAGCGACTGAAAAGCGGCCAGCCTCGGCCTTGTTTGACGTATAACCAAAGCCACCGGGCAACCAATAGCC
CTTGTCACTTTTGATCAGGTAGACCGACCCTGAAGCGCTTTTTTCGTATTCCATAAAACCCCCTTCTGTGCGTGAGTACT
CATAGTATAACAGGCGTGAGTACCAACGCAAGCACTACATGCTGAAATCTGGCCCGCCCCTGTCCATGCCTCGCTGGCGG
GGTGCCGGTGCCCGTGCCAGCTCGGCCCGCGCAAGCTGGACGCTGGGCAGACCCATGACCTTGCTGACGGTGCGCTCGAT
GTAATCCGCTTCGTGGCCGGGCTTGCGCTCTGCCAGCGCTGGGCTGGCCTCGGCCATGGCCTTGCCGATTTCCTCGGCAC
TGCGGCCCCGGCTGGCCAGCTTCTGCGCGGCGATAAAGTCGCACTTGCTGAGGTCATCACCGAAGCGCTTGACCAGCCCG
GCCATCTCGCTGCGGTACTCGTCCAGCGCCGTGCGCCGGTGGCGGCTAAGCTGCCGCTCGGGCAGTTCGAGGCTGGCCAG
CCTGCGGGCCTTCTCCTGCTGCCGCTGGGCCTGCTCGATCTGCTGGCCAGCCTGCTGCACCAGCGCCGGGCCAGCGGTGG
CGGTCTTGCCCTTGGATTCACGCAGCAGCACCCACGGCTGATAACCGGCGCGGGTGGTGTGCTTGTCCTTGCGGTTGGTG
AAGCCCGCCAAGCGGCCATAGTGGCGGCTGTCGGCGCTGGCCGGGTCGGCGTCGTACTCGCTGGCCAGCGTCCGGGCAAT
CTGCCCCCGAAGTTCACCGCCTGCGGCGTCGGCCACCTTGACCCATGCCTGATAGTTCTTCGGGCTGGTTTCCACTACCA
GGGCAGGCTCCCGGCCCTCGGCTTTCATGTCATCCAGGTCAAACTCGCTGAGGTCGTCCACCAGCACCAGACCATGCCGC
TCCTGCTCGGCGGGCCTGATATACACGTCATTGCCCTGGGCATTCATCCGCTTGAGCCATGGCGTGTTCTGGAGCACTTC
GGCGGCTGACCATTCCCGGTTCATCATCTGGCCGGTGGTGGCGTCCCTGACGCCGATATCGAAGCGCTCACAGCCCATGG
CCTTGAGCTGTCGGCCTATGGCCTGCAAAGTCCTGTCGTTCTTCATCGGGCCACCAAGCGCAGCCAGATCGAGCCGTCCT
CGGTTGTCAGTGGCGTCAGGTCGAGCAAGAGCAACGATGCGATCAGCAGCACCACCGTAGGCATCATGGAAGCCAGCATC
ACGGTTAGCCATAGCTTCCAGTGCCACCCCCGCGACGCGCTCCGGGCGCTCTGCGCGGCGCTGCTCACCTCGGCGGCTAC
CTCCCGCAACTCTTTGGCCAGCTCCACCCATGCCGCCCCTGTCTGGCGCTGGGCTTTCAGCCACTCCGCCGCCTGCGCCT
CGCTGGCCTGCTGGGTCTGGCTCATGACCTGCCGGGCTTCGTCGGCCAGTGTCGCCATGCTCTGGGCCAGCGGTTCGATC
TGCTCCGCTAACTCGTTGATGCCTCTGGATTTCTTCACTCTGTCGATTGCGTTCATGGTCTATTGCCTCCCGGTATTCCT
GTAAGTCGATGATCTGGGCGTTGGCGGTGTCGATGTTCAGGGCCACGTCTGCCCGGTCGGTGCGGATGCCCCGGCCTTCC
ATCTCCACCACGTTCGGCCCCAGGTGAACACCGGGCAGGCGCTCGATGCCCTGCGCCTCAAGTGTTCTGTGGTCAATGCG
GGCGTCGTGGCCAGCCCGCTCTAATGCCCGGTTGGCATGGTCGGCCCATGCCTCGCGGGTCTGCTCAAGCCATGCCTTGG
GCTTGAGCGCTTCGGTCTTCTGTGCCCCGCCCTTCTCCGGGGTCTTGCCGTTGTACCGCTTGAACCACTGAGCGGCGGGC
CGCTCGATGCCGTCATTGATCCGCTCGGAGATCATCAGGTGGCAGTGCGGGTTCTCGCCGCCACCGGCATGGATGGCCAG
CGTATACGGCAGGCGCTCGGCACCGGTCAGGTGCTGGGCGAACTCGGACGCCAGCGCCTTCTGCTGGTCGAGGGTCAGCT
CGACCGGCAGGGCAAATTCGACCTCCTTGAACAGCCGCCCATTGGCGCGTTCATACAGGTCGGCAGCATCCCAGTAGTCG
GCGGGCCGCTCGACGAACTCCGGCATGTGCCCGGATTCGGCGTGCAAGACTTCATCCATGTCGCGGGCATACTTGCCTTC
GCGCTGGATGTAGTCGGCCTTGGCCCTGGCCGATTGGCCGCCCGACCTGCTGCCGGTTTTCGCCGTAAGGTGATAAATCG
CCATGCTGCCTCGCTGTTGCTTTTGCTTTTCGGCTCCATGCAATGGCCCTCGGAGAGCGCACCGCCCGAAGGGTGGCCGT
TAGGCCAGTTTCTCGAAGAGAAACCGGTAAGTGCGCCCTCCCCTACAAAGTAGGGTCGGGATTGCCGCCGCTGTGCCTCC
ATGATAGCCTACGAGACAGCACATTAACAATGGGGTGTCAAGATGGTTAAGGGGAGCAACAAGGCGGCGGATCGGCTGGC
CAAGCTCGAAGAACAACGAGCGCGAATCAATGCCGAAATTCAGCGGGTGCGGGCAAGGGAACAGCAGCAAGAGCGCAAGA
ACGAAACAAGGCGCAAGGTGCTGGTGGGGGCCATGATTTTGGCCAAGGTGAACAGCAGCGAGTGGCCGGAGGATCGGCTC
ATGGCGGCAATGGATGCGTACCTTGAACGCGACCACGACCGCGCCTTGTTCGGTCTGCCGCCACGCCAGAAGGATGAGCC
GGGCTGAATGATCGACCGAGACAGGCCCTGCGGGGCTGCACACGCGCCCCCACCCTTCGGGTAGGGGGAAAGGCCGCTAA
AGCGGCTAAAAGCGCTCCAGCGTATTTCTGCGGGGTTTGGTGTGGGGTTTAGCGGGCTTTGCCCGCCTTTCCCCCTGCCG
CGCAGCGGTGGGGCGGTGTGTAGCCTAGCGCAGCGAATAGACCAGCTATCCGGCCTCTGGCCGGGCATATTGGGCAAGGG
CAGCAGCGCCCCACAAGGGCGCTGATAACCGCGCCTAGTGGATTATTCTTAGATAATCATGGATGGATTTTTCCAACACC
CCGCCAGCCCCCGCCCCTGCTGGGTTTGCAGGTTTGGGGGCGTGACAGTTATTGCAGGGGTTCGTGACAGTTATTGCAGG
GGGGCGTGACAGTTATTGCAGGGGTTCGTGACAGTTAGTACGGGAGTGACGGGCACTGGCTGGCAATGTCTAGCAACGGC
AGGCATTTCGGCTGAGGGTAAAAGAACTTTCCGCTAAGCGATAGACTGTATGTAAACACAGTATTGCAAGGACGCGGAAC
ATGCCTCATGTGGCGGCCAGGACGGCCAGCCGGGATCGGGATACTGGTCGTTACCAGAGCCACCGACCCGAGCAAACCCT
TCTCTATCAGATCGTTGACGAGTATTACCCGGCATTCGCTGCGCTTATGGCAGAGCAGGGAAAGGAATTGCCGGGCTATG
TGCAACGGGAATTTGAAGAATTTCTCCAATGCGGGCGGCTGGAGCATGGCTTTCTACGGGTTCGCTGCGAGTCTTGCCAC
GCCGAGCACCTGGTCGCTTTCAGCTGTAATCCGGGCAGCGCAACGGAACATTCATCAGTGTAAAAATGGAATCAATAAAG
CCCTGCGCAGCGCGCAGGGTCAGCCTGAATACGCGTTTAATGACCAGCACAGTCGTGATGGCAAGGTCAGAATAGCGCTG
AGGTCTGCCTCGTGAAGAAGGTGTTGCTGACTCATACCAGGCCTGAATCGCCCCATCATCCAGCCAGAAAGTGAGGGAGC
CACGGTTGATGAGAGCTTTGTTGTAGGTGGACCAGTTGGTGATTTTGAACTTTTGCTTTGCCACGGAACGGTCTGCGTTG
TCGGGAAGATGCGTGATCTGATCCTTCAACTCAGCAAAAGTTCGATTTATTCAACAAAGCCGCCGTCCCGTCAAGTCAGC
GTAATGCTCTGCCAGTGTTACAACCAATTAACCAATTCTGATTAGAAAAACTCATCGAGCATCAAATGAAACTGCAATTT
ATTCATATCAGGATTATCAATACCATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCC
ATAGGATGGCAAGATCCTGGTATCGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTATTAATTTCCCCTCGTCA
AAAATAAGGTTATCAAGTGAGAAATCACCATGAGTGACGACTGAATCCGGTGAGAATGGCAAAAGCTTATGCATTTCTTT
CCAGACTTGTTCAACAGGCCAGCCATTACGCTCGTCATCAAAATCACTCGCATCAACCAAACCGTTATTCATTCGTGATT
GCGCCTGAGCGAGACGAAATACGCGATCGCTGTTAAAAGGACAATTACAAACAGGAATCGAATGCAACCGGCGCAGGAAC
ACTGCCAGCGCATCAACAATATTTTCACCTGAATCAGGATATTCTTCTAATACCTGGAATGCTGTTTTCCCGGGGATCGC
AGTGGTGAGTAACCATGCATCATCAGGAGTACGGATAAAATGCTTGATGGTCGGAAGAGGCATAAATTCCGTCAGCCAGT
TTAGTCTGACCATCTCATCTGTAACATCATTGGCAACGCTACCTTTGCCATGTTTCAGAAACAACTCTGGCGCATCGGGC
TTCCCATACAATCGATAGATTGTCGCACCTGATTGCCCGACATTATCGCGAGCCCATTTATACCCATATAAATCAGCATC
CATGTTGGAATTTAATCGCGGCCTCGAGCAAGACGTTTCCCGTTGAATATGGCTCATAGCACCCCTTGTATTACTGTTTA
TGTAAGCAGA
//

NOTE: For research use only!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart