pDsRed- Express2- N1

$215.00

  • Model: PVT10758
  • 50 Units in Stock
Ask a question


Add to Cart:

pDsRed-Express2-N1


Catalog No. PVT10758
Packing 2ug

 

pDsRed-Express2-N1 Information


Function Mammalian fluorescent plasmid

romoter: CMV

Replicator: pUC ori, F1 ori

Terminator: SV40 poly (A) signal

Plasmid classification: mammalian cells, fluorescent protein reporter vectors

Prokaryotic resistance: kanamycin Kan

Screening markers: neomycin Neo/ hereditary mycin G418

Cloned strain: Escherichia coli DH5 alpha

Culture conditions: 37 centigrade, aerobic, LB

Expression host: mammalian cells

Induction mode: no induction, instantaneous expression

5'sequencing primers: CMV-F:CGCAAATGGGCGGTAGGCGTG

3'sequencing primers: Sv40-polyA-R:GAAATTTGTGATGCTATTGC

 

pDsRed-Express2-N1 Description

pDsRed-Express2-N1 is a mammalian expression vector designed to express a protein of interest fused to the N-terminus of DsRed-Express2, a variant of the Discosoma sp. red fluorescent protein, DsRed (1). DsRed-Express2 retains the fast maturation and high photostability characteristic of its predecessor, DsRed-Express (2), and has been engineered (through additional amino acid substitutions) for increased solubility (3). Although it most likely forms the same tetrameric structure as wild-type DsRed, DsRed-Express2 displays a greatly reduced tendency to aggregate, resulting in reduced cyto- and phototoxicity, and making DsRed-Express2 much better suited for in vivo applications involving sensitive cells, such as primary or stem cells. (Please note: Because DsRed-Express2 likely forms tetramers, its suitability as a fusion partner will largely depend on how its tetramerization affects the function of the protein to which it is fused.) DsRed-Express2 also exhibits extremely low residual green fluorescence, which allows cells expressing the protein to be effectively separated from other fluorescently labeled cell populations by flow cytometry. The multiple cloning site (MCS) in pDsRed-Express2-N1 is positioned upstream of the DsRed-Express2 coding sequence. A Kozak consensus sequence (4), located between the MCS and the DsRed-Express2 coding sequence, enhances the translational efficiency of the unfused DsRed-Express2 protein in eukaryotic cells. SV40 polyadenylation signals downstream of the DsRed-Express2 coding sequence direct proper processing of the 3' ends of the DsRed-Express2 and fusion gene mRNA transcripts.

pDsRed-Express2-N1-vector

 

pDsRed-Express2-N1 Sequence

  ORIGIN      1 TAGTTATTAA TAGTAATCAA TTACGGGGTC ATTAGTTCAT AGCCCATATA TGGAGTTCCG     61 CGTTACATAA CTTACGGTAA ATGGCCCGCC TGGCTGACCG CCCAACGACC CCCGCCCATT    121 GACGTCAATA ATGACGTATG TTCCCATAGT AACGCCAATA GGGACTTTCC ATTGACGTCA    181 ATGGGTGGAG TATTTACGGT AAACTGCCCA CTTGGCAGTA CATCAAGTGT ATCATATGCC    241 AAGTACGCCC CCTATTGACG TCAATGACGG TAAATGGCCC GCCTGGCATT ATGCCCAGTA    301 CATGACCTTA TGGGACTTTC CTACTTGGCA GTACATCTAC GTATTAGTCA TCGCTATTAC    361 CATGGTGATG CGGTTTTGGC AGTACATCAA TGGGCGTGGA TAGCGGTTTG ACTCACGGGG    421 ATTTCCAAGT CTCCACCCCA TTGACGTCAA TGGGAGTTTG TTTTGGCACC AAAATCAACG    481 GGACTTTCCA AAATGTCGTA ACAACTCCGC CCCATTGACG CAAATGGGCG GTAGGCGTGT    541 ACGGTGGGAG GTCTATATAA GCAGAGCTGG TTTAGTGAAC CGTCAGATCC GCTAGCGCTA    601 CCGGACTCAG ATCTCGAGCT CAAGCTTCGA ATTCTGCAGT CGACGGTACC GCGGGCCCGG    661 GATCCACTAG TCGCCACCAT GGATAGCACT GAGAACGTCA TCAAGCCCTT CATGCGCTTC    721 AAGGTGCACA TGGAGGGCTC CGTGAACGGC CACGAGTTCG AGATCGAGGG CGAGGGCGAG    781 GGCAAGCCCT ACGAGGGCAC CCAGACCGCC AAGCTGCAGG TGACCAAGGG CGGCCCCCTG    841 CCCTTCGCCT GGGACATCCT GTCCCCCCAG TTCCAGTACG GCTCCAAGGT GTACGTGAAG    901 CACCCCGCCG ACATCCCCGA CTACAAGAAG CTGTCCTTCC CCGAGGGCTT CAAGTGGGAG    961 CGCGTGATGA ACTTCGAGGA CGGCGGCGTG GTGACCGTGA CCCAGGACTC CTCCCTGCAG   1021 GACGGCACCT TCATCTACCA CGTGAAGTTC ATCGGCGTGA ACTTCCCCTC CGACGGCCCC   1081 GTAATGCAGA AGAAGACTCT GGGCTGGGAG CCCTCCACCG AGCGCCTGTA CCCCCGCGAC   1141 GGCGTGCTGA AGGGCGAGAT CCACAAGGCG CTGAAGCTGA AGGGCGGCGG CCACTACCTG   1201 GTGGAGTTCA AGTCAATCTA CATGGCCAAG AAGCCCGTGA AGCTGCCCGG CTACTACTAC   1261 GTGGACTCCA AGCTGGACAT CACCTCCCAC AACGAGGACT ACACCGTGGT GGAGCAGTAC   1321 GAGCGCGCCG AGGCCCGCCA CCACCTGTTC CAGTAGCGGC CGCGACTCTA GATCATAATC   1381 AGCCATACCA CATTTGTAGA GGTTTTACTT GCTTTAAAAA ACCTCCCACA CCTCCCCCTG   1441 AACCTGAAAC ATAAAATGAA TGCAATTGTT GTTGTTAACT TGTTTATTGC AGCTTATAAT   1501 GGTTACAAAT AAAGCAATAG CATCACAAAT TTCACAAATA AAGCATTTTT TTCACTGCAT   1561 TCTAGTTGTG GTTTGTCCAA ACTCATCAAT GTATCTTAAG GCGTAAATTG TAAGCGTTAA   1621 TATTTTGTTA AAATTCGCGT TAAATTTTTG TTAAATCAGC TCATTTTTTA ACCAATAGGC   1681 CGAAATCGGC AAAATCCCTT ATAAATCAAA AGAATAGACC GAGATAGGGT TGAGTGTTGT   1741 TCCAGTTTGG AACAAGAGTC CACTATTAAA GAACGTGGAC TCCAACGTCA AAGGGCGAAA   1801 AACCGTCTAT CAGGGCGATG GCCCACTACG TGAACCATCA CCCTAATCAA GTTTTTTGGG   1861 GTCGAGGTGC CGTAAAGCAC TAAATCGGAA CCCTAAAGGG AGCCCCCGAT TTAGAGCTTG   1921 ACGGGGAAAG CCGGCGAACG TGGCGAGAAA GGAAGGGAAG AAAGCGAAAG GAGCGGGCGC   1981 TAGGGCGCTG GCAAGTGTAG CGGTCACGCT GCGCGTAACC ACCACACCCG CCGCGCTTAA   2041 TGCGCCGCTA CAGGGCGCGT CAGGTGGCAC TTTTCGGGGA AATGTGCGCG GAACCCCTAT   2101 TTGTTTATTT TTCTAAATAC ATTCAAATAT GTATCCGCTC ATGAGACAAT AACCCTGATA   2161 AATGCTTCAA TAATATTGAA AAAGGAAGAG TCCTGAGGCG GAAAGAACCA GCTGTGGAAT   2221 GTGTGTCAGT TAGGGTGTGG AAAGTCCCCA GGCTCCCCAG CAGGCAGAAG TATGCAAAGC   2281 ATGCATCTCA ATTAGTCAGC AACCAGGTGT GGAAAGTCCC CAGGCTCCCC AGCAGGCAGA   2341 AGTATGCAAA GCATGCATCT CAATTAGTCA GCAACCATAG TCCCGCCCCT AACTCCGCCC   2401 ATCCCGCCCC TAACTCCGCC CAGTTCCGCC CATTCTCCGC CCCATGGCTG ACTAATTTTT   2461 TTTATTTATG CAGAGGCCGA GGCCGCCTCG GCCTCTGAGC TATTCCAGAA GTAGTGAGGA   2521 GGCTTTTTTG GAGGCCTAGG CTTTTGCAAA GATCGATCAA GAGACAGGAT GAGGATCGTT   2581 TCGCATGATT GAACAAGATG GATTGCACGC AGGTTCTCCG GCCGCTTGGG TGGAGAGGCT   2641 ATTCGGCTAT GACTGGGCAC AACAGACAAT CGGCTGCTCT GATGCCGCCG TGTTCCGGCT   2701 GTCAGCGCAG GGGCGCCCGG TTCTTTTTGT CAAGACCGAC CTGTCCGGTG CCCTGAATGA   2761 ACTGCAAGAC GAGGCAGCGC GGCTATCGTG GCTGGCCACG ACGGGCGTTC CTTGCGCAGC   2821 TGTGCTCGAC GTTGTCACTG AAGCGGGAAG GGACTGGCTG CTATTGGGCG AAGTGCCGGG   2881 GCAGGATCTC CTGTCATCTC ACCTTGCTCC TGCCGAGAAA GTATCCATCA TGGCTGATGC   2941 AATGCGGCGG CTGCATACGC TTGATCCGGC TACCTGCCCA TTCGACCACC AAGCGAAACA   3001 TCGCATCGAG CGAGCACGTA CTCGGATGGA AGCCGGTCTT GTCGATCAGG ATGATCTGGA   3061 CGAAGAGCAT CAGGGGCTCG CGCCAGCCGA ACTGTTCGCC AGGCTCAAGG CGAGCATGCC   3121 CGACGGCGAG GATCTCGTCG TGACCCATGG CGATGCCTGC TTGCCGAATA TCATGGTGGA   3181 AAATGGCCGC TTTTCTGGAT TCATCGACTG TGGCCGGCTG GGTGTGGCGG ACCGCTATCA   3241 GGACATAGCG TTGGCTACCC GTGATATTGC TGAAGAGCTT GGCGGCGAAT GGGCTGACCG   3301 CTTCCTCGTG CTTTACGGTA TCGCCGCTCC CGATTCGCAG CGCATCGCCT TCTATCGCCT   3361 TCTTGACGAG TTCTTCTGAG CGGGACTCTG GGGTTCGAAA TGACCGACCA AGCGACGCCC   3421 AACCTGCCAT CACGAGATTT CGATTCCACC GCCGCCTTCT ATGAAAGGTT GGGCTTCGGA   3481 ATCGTTTTCC GGGACGCCGG CTGGATGATC CTCCAGCGCG GGGATCTCAT GCTGGAGTTC   3541 TTCGCCCACC CTAGGGGGAG GCTAACTGAA ACACGGAAGG AGACAATACC GGAAGGAACC   3601 CGCGCTATGA CGGCAATAAA AAGACAGAAT AAAACGCACG GTGTTGGGTC GTTTGTTCAT   3661 AAACGCGGGG TTCGGTCCCA GGGCTGGCAC TCTGTCGATA CCCCACCGAG ACCCCATTGG   3721 GGCCAATACG CCCGCGTTTC TTCCTTTTCC CCACCCCACC CCCCAAGTTC GGGTGAAGGC   3781 CCAGGGCTCG CAGCCAACGT CGGGGCGGCA GGCCCTGCCA TAGCCTCAGG TTACTCATAT   3841 ATACTTTAGA TTGATTTAAA ACTTCATTTT TAATTTAAAA GGATCTAGGT GAAGATCCTT   3901 TTTGATAATC TCATGACCAA AATCCCTTAA CGTGAGTTTT CGTTCCACTG AGCGTCAGAC   3961 CCCGTAGAAA AGATCAAAGG ATCTTCTTGA GATCCTTTTT TTCTGCGCGT AATCTGCTGC   4021 TTGCAAACAA AAAAACCACC GCTACCAGCG GTGGTTTGTT TGCCGGATCA AGAGCTACCA   4081 ACTCTTTTTC CGAAGGTAAC TGGCTTCAGC AGAGCGCAGA TACCAAATAC TGTTCTTCTA   4141 GTGTAGCCGT AGTTAGGCCA CCACTTCAAG AACTCTGTAG CACCGCCTAC ATACCTCGCT   4201 CTGCTAATCC TGTTACCAGT GGCTGCTGCC AGTGGCGATA AGTCGTGTCT TACCGGGTTG   4261 GACTCAAGAC GATAGTTACC GGATAAGGCG CAGCGGTCGG GCTGAACGGG GGGTTCGTGC   4321 ACACAGCCCA GCTTGGAGCG AACGACCTAC ACCGAACTGA GATACCTACA GCGTGAGCTA   4381 TGAGAAAGCG CCACGCTTCC CGAAGGGAGA AAGGCGGACA GGTATCCGGT AAGCGGCAGG   4441 GTCGGAACAG GAGAGCGCAC GAGGGAGCTT CCAGGGGGAA ACGCCTGGTA TCTTTATAGT   4501 CCTGTCGGGT TTCGCCACCT CTGACTTGAG CGTCGATTTT TGTGATGCTC GTCAGGGGGG   4561 CGGAGCCTAT GGAAAAACGC CAGCAACGCG GCCTTTTTAC GGTTCCTGGC CTTTTGCTGG   4621 CCTTTTGCTC ACATGTTCTT TCCTGCGTTA TCCCCTGATT CTGTGGATAA CCGTATTACC   4681 GCCATGCAT  //
No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart