pDsRed2- ER Plasmid


  • Model: PVT1215
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pDsRed2-ER,Plasmid pDsRed2-ER,pDsRed2-ER vector

pDsRed2-ER plasmid information

Promoter: CMV promoter
Replicator: pUC, ori, F1, ori
Terminator: SV40, poly (A) signal
Plasmid classification: mammalian plasmids, mammalian fluorescent plasmids, and mammalian red plasmids
Plasmid size: 4757bp
Plasmid Tags: N-DsRed2
Prokaryotic resistance: kanamycin Kan (50 g/ml)
Screening marker: neomycin Neo/G418
Clone strain: DH5 alpha and other Escherichia coli
Culture conditions: 37 DEG C, aerobic LB
Expressing host: 293T and other mammalian cells
Culture condition: no induction, transient expression
Induction mode: no induction, transient expression
Primers for 5'sequencing: CMV-F (CGCAAATGGGCGGTAGGCGTG)
Primers for 3'sequencing: SV40-polyA-R (GAAATTTGTGATGCTATTGC)
Note: endoplasmic reticulum marker plasmids in mammalian cells
Plasmid profiles

pDsRed2-ER plasmid Description

The vector encodes a fusion consisting of Discosoma sp. red fluorescent protein; the endoplasmic reticulum (ER) targeting sequence of calreticulin , fused to the 5' end of DsRed2; and the ER retention sequence, KDEL, fused to the 3' end of DsRed2. DsRed2 is a human codon-optimized variant of wild-type DsRed that has been engineered for faster maturation and lower non-specific aggregation.To drive expression of DsRed2, this vector contains the immediate early promoter of cytomegalovirus (PCMV IE). SV40 polyadenylation signals downstream of the DsRed2 gene direct proper processing of the 3'-end of the DsRed2 mRNA transcript. The vector also contains an SV40 origin for replication in any mammalian cell line that expresses the SV40 Tantigen, a pUC origin of replication for propagation in E. coli, and an f1 origin for single-stranded DNA production. A neomycin resistance cassette—consisting of the SV40 early promoter (PSV40e), the neomycin/kanamycin resistance gene of Tn5 (Neor/Kanr), and polyadenylation signals from the herpes simplex virus thymidine kinase (HSV TK poly A) gene— allows stably transfected eukaryotic cells to be selected using G418 . A bacterial promoter (P) upstream of this cassette drives expression of the gene encoding kanamycin resistance in E. coli.pDsRed2-ER can be introduced into mammalian cells using any standard transfection method. If required, stable transformants can be selected using G418 .

pDsRed2-ER plasmid Sequence

LOCUS       Exported                4757 bp ds-DNA    circular SYN 18-10-2015
KEYWORDS    Untitled 6
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4757)
  AUTHORS   admin
  TITLE     Direct Submission
  JOURNAL   Exported 2015-10-18  
FEATURES             Location/Qualifiers
     source          1..4757
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     enhancer        61..364
                     /note="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        365..568
                     /note="CMV promoter"
                     /note="human cytomegalovirus (CMV) immediate early 
     CDS             663..1337
                     /product="improved tetrameric variant of DsRed fluorescent 
                     /note="mammalian codon-optimized"
     misc_feature    1365..1421
                     /note="multiple cloning site"
     polyA_signal    1545..1666
                     /note="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     rep_origin      complement(1673..2128)
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow 
                     indicates direction of (+) strand synthesis"
     promoter        2155..2259
                     /note="AmpR promoter"
     promoter        2261..2618
                     /note="SV40 promoter"
                     /note="SV40 enhancer and early promoter"
     rep_origin      2469..2604
                     /note="SV40 ori"
                     /note="SV40 origin of replication"
     CDS             2653..3447
                     /gene="aph(3')-II (or nptII)"
                     /product="aminoglycoside phosphotransferase from Tn5"
                     /note="confers resistance to neomycin, kanamycin, and G418 
     polyA_signal    3679..3726
                     /note="HSV TK poly(A) signal"
                     /note="herpesvirus thymidine kinase polyadenylation signal"
     rep_origin      4055..4643
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
        1 tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata tggagttccg
       61 cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt
      121 gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc attgacgtca
      181 atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt atcatatgcc
      241 aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt atgcccagta
      301 catgacctta tgggactttc ctacttggca gtacatctac gtattagtca tcgctattac
      361 catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg actcacgggg
      421 atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc aaaatcaacg
      481 ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg gtaggcgtgt
      541 acggtgggag gtctatataa gcagagctgg tttagtgaac cgtcagatcc gctagcatgc
      601 tgctatccgt gccgttgctg ctcggcctcc tcggcctggc cgtcgccgac cggtcgcaca
      661 ccatggcctc ctccgagaac gtcatcaccg agttcatgcg cttcaaggtg cgcatggagg
      721 gcaccgtgaa cggccacgag ttcgagatcg agggcgaggg cgagggccgc ccctacgagg
      781 gccacaacac cgtgaagctg aaggtgacca agggcggccc cctgcccttc gcctgggaca
      841 tcctgtcccc ccagttccag tacggctcca aggtgtacgt gaagcacccc gccgacatcc
      901 ccgactacaa gaagctgtcc ttccccgagg gcttcaagtg ggagcgcgtg atgaacttcg
      961 aggacggcgg cgtggcgacc gtgacccagg actcctccct gcaggacggc tgcttcatct
     1021 acaaggtgaa gttcatcggc gtgaacttcc cctccgacgg ccccgtgatg cagaagaaga
     1081 ccatgggctg ggaggcctcc accgagcgcc tgtacccccg cgacggcgtg ctgaagggcg
     1141 agacccacaa ggccctgaag ctgaaggacg gcggccacta cctggtggag ttcaagtcca
     1201 tctacatggc caagaagccc gtgcagctgc ccggctacta ctacgtggac gccaagctgg
     1261 acatcacctc ccacaacgag gactacacca tcgtggagca gtacgagcgc accgagggcc
     1321 gccaccacct gttcctgaga tcgtacaaga aggacgagct gtaaagatct cgagctcaag
     1381 cttcgaattc tgcagtcgac ggtaccgcgg gcccgggatc caccggatct agataactga
     1441 tcataatcag ccataccaca tttgtagagg ttttacttgc tttaaaaaac ctcccacacc
     1501 tccccctgaa cctgaaacat aaaatgaatg caattgttgt tgttaacttg tttattgcag
     1561 cttataatgg ttacaaataa agcaatagca tcacaaattt cacaaataaa gcattttttt
     1621 cactgcattc tagttgtggt ttgtccaaac tcatcaatgt atcttaaggc gtaaattgta
     1681 agcgttaata ttttgttaaa attcgcgtta aattt
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
