pDsRed2- Mito Plasmid


  • Model: PVT1216
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pDsRed2-Mito,Plasmid pDsRed2-Mito,pDsRed2-Mito vector



pDsRed2-Mito Information

Promoter: CMV promoter

Replicator: pUC ori, F1 ori

Terminator: SV40 poly (A) signal

Plasmid classification: lactation serial plasmids; lactating fluorescent plasmids; lactating red plasmids

Plasmid size: 4715bp

Plasmid label: N-DsRed2

Prokaryotic resistance: kanamycin Kan (50 mu g/ml)

Screening markers: neomycin Neo/G418

Cloned strains of Escherichia coli, DH5 A and other Escherichia coli

Culture conditions: 37 centigrade, aerobic LB

Expression host: mammalian cells such as 293T

Culture conditions: 37 C, 5%CO2

Induction mode: no induction, instantaneous expression

5'sequencing primers: CMV-F (CGCAAATGGGCGGTAGGCGTG)

3'sequencing primers: SV40-polyA-R (GAAATTTGTGATGCTATTGC)

Remarks: the red fluorescent localization plasmid of mammalian mitochondria


pDsRed2-Mito Description

PDsRed2-Mito is a mitochondrial localization plasmid of mammalian cells, which contains the mitochondrial targeting sequence of the codon optimized red fluorescent protein gene DsRed2 and human cytochrome c oxidase (Mito) subunit VIII.

pDsRed2-Mito is a mammalian expression vector that encodes a fusion of Discosoma sp. Red fluorescent protein (DsRed2; 1, 2) and the mitochondrial targeting sequence from subunit VIII of human cytochrome c oxidase (Mito; 3, 4). The Mito sequence is fused to the 5'-end of DsRed2, a human codon-optimized DsRed variant that is engineered for faster maturation and lower nonspecific aggregation (1, 5). The Mito sequence targets the Mito-DsRed2 fusion protein to the host cell’s mitochondria. To drive expression of Mito-DsRed2, this vector contains the immmediate early promoter of cytomegalovirus (PCMV IE ). SV40 polyadenylation signals downstream of the DsRed2 gene direct proper processing of the 3'-end of the Mito-DsRed2 mRNA. This vector also contains an SV40 origin for replication in any mammalian cell line that expresses the SV40 T-antigen, a pUC origin of replication for propagation in E. coli, and an f1 origin for single-stranded DNA production. A neomycin resistance cassette—consisting of the SV40 early promoter (PSV40e), the neomycin/kanamycin resistance gene of Tn5 (Neor/Kanr), and polyadenylation signals from the herpes simplex virus thymidine kinase (HSV TK poly A) gene—allow stably transfected eukaryotic cells to be selected using G418 (6). A bacterial promoter (P) upstream of this cassette drives expression of the gene encoding kanamycin resistance in E. coli. pDsRed2-Mito is designed for fluorescent labeling of mitochondria. The vector can be introduced into mammalian cells using any standard transfection method. If required, stable transformants can be selected using G418 (6). The Mito-DsRed2 fusion (excitation/emission maxima: 558 nm/583 nm) can be detected by fluorescence microscopy and by flow cytometry. Filter sets optimized for detecting DsRed by microscopy are available from Chroma Technology Corporation and Omega Optical Inc. Please see their websites (www.chroma.com and www.omegafilters.com) and the Living Colors® Vol. II User Manual, provided with this vector, for more information. To detect MitoDsRed2-expressing cells by flow cytometry, use the instrument’s argon-ion laser to excite the fluorophore at 488 nm and the FL-2 channel to detect the fluorophore’s emission at 583 nm.



pDsRed2-Mito Sequence

LOCUS       Exported                4715 bp ds-DNA    circular SYN 02-8-2017
KEYWORDS    pDsRed2-Mito
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4715)
  TITLE     Direct Submission
  JOURNAL   Exported 2017-8-2 
FEATURES             Location/Qualifiers
     source          1..4715
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     enhancer        61..364
                     /note="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        365..568
                     /note="CMV promoter"
                     /note="human cytomegalovirus (CMV) immediate early 
     misc_feature    597..683
     CDS             705..1382
                     /product="improved tetrameric variant of DsRed fluorescent 
                     /note="mammalian codon-optimized"
     polyA_signal    1503..1624
                     /note="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     rep_origin      complement(1631..2086)
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow 
                     indicates direction of (+) strand synthesis"
     promoter        2113..2217
                     /note="AmpR promoter"
     promoter        2219..2576
                     /note="SV40 promoter"
                     /note="SV40 enhancer and early promoter"
     rep_origin      2427..2562
                     /note="SV40 ori"
                     /note="SV40 origin of replication"
     CDS             2611..3405
                     /gene="aph(3')-II (or nptII)"
                     /product="aminoglycoside phosphotransferase from Tn5"
                     /note="confers resistance to neomycin, kanamycin, and G418 
     polyA_signal    3637..3684
                     /note="HSV TK poly(A) signal"
                     /note="herpes simplex virus thymidine kinase 
                     polyadenylation signal (Cole and Stacy, 1985)"
     rep_origin      4013..4601
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
        1 tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata tggagttccg
       61 cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt
      121 gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc attgacgtca
      181 atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt atcatatgcc
      241 aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt atgcccagta
      301 catgacctta tgggactttc ctacttggca gtacatctac gtattagtca tcgctattac
      361 catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg actcacgggg
      421 atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc aaaatcaacg
      481 ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg gtaggcgtgt
      541 acggtgggag gtctatataa gcagagctgg tttagtgaac cgtcagatcc gctagcatgt
      601 ccgtcctgac gccgctgctg ctgcggggct tgacaggctc ggcccggcgg ctcccagtgc
      661 cgcgcgccaa gatccattcg ttgggggatc caccggtcgc caccatggcc tcctccgaga
      721 acgtcatcac cgagttcatg cgcttcaagg tgcgcatgga gggcaccgtg aacggccacg
      781 agttcgagat cgagggcgag ggcgagggcc gcccctacga gggccacaac accgtgaagc
      841 tgaaggtgac caagggcggc cccctgccct tcgcctggga catcctgtcc ccccagttcc
      901 agtacggctc caaggtgtac gtgaagcacc ccgccgacat ccccgactac aagaagctgt
      961 ccttccccga gggcttcaag tgggagcgcg tgatgaactt cgaggacggc ggcgtggcga
     1021 ccgtgaccca ggactcctcc ctgcaggacg gctgcttcat ctacaaggtg aagttcatcg
     1081 gcgtgaactt cccctccgac ggccccgtga tgcagaagaa gaccatgggc tgggaggcct
     1141 ccaccgagcg cctgtacccc cgcgacggcg tgctgaaggg cgagacccac aaggccctga
     1201 agctgaagga cggcggccac tacctggtgg agttcaagtc catctacatg gccaagaagc
     1261 ccgtgcagct gcccggctac tactacgtgg acgccaagct ggacatcacc tcccacaacg
     1321 aggactacac catcgtggag cagtacgagc gcaccgaggg ccgccaccac ctgttcctgt
     1381 agcggccgcg actctagatc ataatcagcc ataccacatt tgtagaggtt ttacttgctt
     1441 taaaaaacct cccacacctc cccctgaacc tgaaacataa aatgaatgca attgttgttg
     1501 ttaacttgtt tattgcagct tataatggtt acaaataaag caatagcatc acaaatttca
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
