pDsRed2-1

$280.00

  • Model: PVTY00642
  • 20 Units in Stock
Ask a question


Add to Cart:

pDsRed2-1

PVTY00642  2ug

pDsRed2-1 Description

Plasmid type: Fluorescent protein reporter vector Cloning Method: Multiple cloning sites,restriction endonuclease Size: 4107 bp 5' Sequencing primers and sequences: DsRed1-N:?'d[GTACTGGAACTGGGGGGACAG] Resistance(s): Kanamycin (Kan) Selectable markers: Neomycin (Neomycin) Note: Red fluorescent protein reporter. Used to monitor transcription from cis-regulatory elements.

Caution:
1.  This product is FOR RESEARCH USE ONLY!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart