pDsRed2-C1

$280.00

  • Model: PVTY00975
  • 20 Units in Stock
Ask a question


Add to Cart:

pDsRed2-C1

PVTY00975  2ug

pDsRed2-C1 Description

Plasmid type: Mammalian cell expression vector Promoter: CMV Cloning Method: Multiple cloning sites,restriction endonuclease Size: 4675 bp 5' Sequencing primers and sequences: DsRed1-C: 5'd[AGCTGGACATCACCTCCCACAACG] Tags: DsRed2 (Nterm) Resistance(s): Kanamycin (Kan) Selectable markers: Neomycin (Neomycin) Note: Red fluorescent protein tag

Caution:
1.  This product is FOR RESEARCH USE ONLY!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart