pDsRed2-ER Plasmid


  • Model: PVT1215
  • 49 Units in Stock
Ask a question

Add to Cart:

pDsRed2-ER Plasmid

PVT1215        2ug


pDsRed2-ER Plasmid Information

Promoter: CMV promoter
Replicator: pUC, ori, F1, ori
Terminator: SV40, poly (A) signal
Plasmid classification: mammalian plasmids, mammalian fluorescent plasmids, and mammalian red plasmids
Plasmid size: 4757bp
Plasmid Tags: N-DsRed2
Prokaryotic resistance: kanamycin Kan (50 g/ml)
Screening marker: neomycin Neo/G418
Clone strain: DH5 alpha and other Escherichia coli
Culture conditions: 37 DEG C, aerobic LB
Expressing host: 293T and other mammalian cells
Culture condition: no induction, transient expression
Induction mode: no induction, transient expression
Primers for 5'sequencing: CMV-F (CGCAAATGGGCGGTAGGCGTG)
Primers for 3'sequencing: SV40-polyA-R (GAAATTTGTGATGCTATTGC)
Note: endoplasmic reticulum marker plasmids in mammalian cells
Plasmid profiles


pDsRed2-ER Plasmid Description

pDsRed2-ER Plasmid encodes a fusion consisting of Discosoma sp. red fluorescent protein; the endoplasmic reticulum (ER) targeting sequence of calreticulin , fused to the 5' end of DsRed2; and the ER retention sequence, KDEL, fused to the 3' end of DsRed2. DsRed2 is a human codon-optimized variant of wild-type DsRed that has been engineered for faster maturation and lower non-specific aggregation.To drive expression of DsRed2, this vector contains the immediate early promoter of cytomegalovirus (PCMV IE). SV40 polyadenylation signals downstream of the DsRed2 gene direct proper processing of the 3'-end of the DsRed2 mRNA transcript. The vector also contains an SV40 origin for replication in any mammalian cell line that expresses the SV40 Tantigen, a pUC origin of replication for propagation in E. coli, and an f1 origin for single-stranded DNA production. A neomycin resistance cassette—consisting of the SV40 early promoter (PSV40e), the neomycin/kanamycin resistance gene of Tn5 (Neor/Kanr), and polyadenylation signals from the herpes simplex virus thymidine kinase (HSV TK poly A) gene— allows stably transfected eukaryotic cells to be selected using G418 . A bacterial promoter (P) upstream of this cassette drives expression of the gene encoding kanamycin resistance in E. coli.pDsRed2-ER can be introduced into mammalian cells using any standard transfection method. If required, stable transformants can be selected using G418 .


pDsRed2-ER plasmid Sequence

LOCUS       Exported                4757 bp ds-DNA    circular SYN 18-10-2015

KEYWORDS    Untitled 6

SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 4757)

  AUTHORS   admin

  TITLE     Direct Submission

  JOURNAL   Exported 2015-10-18  

FEATURES             Location/Qualifiers

     source          1..4757

                     /organism="synthetic DNA construct"

                     /mol_type="other DNA"

     enhancer        61..364

                     /note="CMV enhancer"

                     /note="human cytomegalovirus immediate early enhancer"

     promoter        365..568

                     /note="CMV promoter"

                     /note="human cytomegalovirus (CMV) immediate early 


     CDS             663..1337


                     /product="improved tetrameric variant of DsRed fluorescent 



                     /note="mammalian codon-optimized"






     misc_feature    1365..1421


                     /note="multiple cloning site"

     polyA_signal    1545..1666

                     /note="SV40 poly(A) signal"

                     /note="SV40 polyadenylation signal"

     rep_origin      complement(1673..2128)


                     /note="f1 ori"

                     /note="f1 bacteriophage origin of replication; arrow 

                     indicates direction of (+) strand synthesis"

     promoter        2155..2259


                     /note="AmpR promoter"

     promoter        2261..2618

                     /note="SV40 promoter"

                     /note="SV40 enhancer and early promoter"

     rep_origin      2469..2604

                     /note="SV40 ori"

                     /note="SV40 origin of replication"

     CDS             2653..3447


                     /gene="aph(3')-II (or nptII)"

                     /product="aminoglycoside phosphotransferase from Tn5"


                     /note="confers resistance to neomycin, kanamycin, and G418 







     polyA_signal    3679..3726

                     /note="HSV TK poly(A) signal"

                     /note="herpesvirus thymidine kinase polyadenylation signal"

     rep_origin      4055..4643



                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 



        1 tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata tggagttccg

       61 cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt

      121 gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc attgacgtca

      181 atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt atcatatgcc

      241 aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt atgcccagta

      301 catgacctta tgggactttc ctacttggca gtacatctac gtattagtca tcgctattac

      361 catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg actcacgggg

      421 atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc aaaatcaacg

      481 ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg gtaggcgtgt

      541 acggtgggag gtctatataa gcagagctgg tttagtgaac cgtcagatcc gctagcatgc

      601 tgctatccgt gccgttgctg ctcggcctcc tcggcctggc cgtcgccgac cggtcgcaca

      661 ccatggcctc ctccgagaac gtcatcaccg agttcatgcg cttcaaggtg cgcatggagg

      721 gcaccgtgaa cggccacgag ttcgagatcg agggcgaggg cgagggccgc ccctacgagg

      781 gccacaacac cgtgaagctg aaggtgacca agggcggccc cctgcccttc gcctgggaca

      841 tcctgtcccc ccagttccag tacggctcca aggtgtacgt gaagcacccc gccgacatcc

      901 ccgactacaa gaagctgtcc ttccccgagg gcttcaagtg ggagcgcgtg atgaacttcg

      961 aggacggcgg cgtggcgacc gtgacccagg actcctccct gcaggacggc tgcttcatct

     1021 acaaggtgaa gttcatcggc gtgaacttcc cctccgacgg ccccgtgatg cagaagaaga

     1081 ccatgggctg ggaggcctcc accgagcgcc tgtacccccg cgacggcgtg ctgaagggcg

     1141 agacccacaa ggccctgaag ctgaaggacg gcggccacta cctggtggag ttcaagtcca

     1201 tctacatggc caagaagccc gtgcagctgc ccggctacta ctacgtggac gccaagctgg

     1261 acatcacctc ccacaacgag gactacacca tcgtggagca gtacgagcgc accgagggcc

     1321 gccaccacct gttcctgaga tcgtacaaga aggacgagct gtaaagatct cgagctcaag

     1381 cttcgaattc tgcagtcgac ggtaccgcgg gcccgggatc caccggatct agataactga

     1441 tcataatcag ccataccaca tttgtagagg ttttacttgc tttaaaaaac ctcccacacc

     1501 tccccctgaa cctgaaacat aaaatgaatg caattgttgt tgttaacttg tttattgcag

     1561 cttataatgg ttacaaataa agcaatagca tcacaaattt cacaaataaa gcattttttt

     1621 cactgcattc tagttgtggt ttgtccaaac tcatcaatgt atcttaaggc gtaaattgta

     1681 agcgttaata ttttgttaaa attcgcgtta aatttttgtt aaatcagctc attttttaac

     1741 caataggccg aaatcggcaa aatcccttat aaatcaaaag aatagaccga gatagggttg

     1801 agtgttgttc cagtttggaa caagagtcca ctattaaaga acgtggactc caacgtcaaa

     1861 gggcgaaaaa ccgtctatca gggcgatggc ccactacgtg aaccatcacc ctaatcaagt

     1921 tttttggggt cgaggtgccg taaagcacta aatcggaacc ctaaagggag cccccgattt

     1981 agagcttgac ggggaaagcc ggcgaacgtg gcgagaaagg aagggaagaa agcgaaagga

     2041 gcgggcgcta gggcgctggc aagtgtagcg gtcacgctgc gcgtaaccac cacacccgcc

     2101 gcgcttaatg cgccgctaca gggcgcgtca ggtggcactt ttcggggaaa tgtgcgcgga

     2161 acccctattt gtttattttt ctaaatacat tcaaatatgt atccgctcat gagacaataa

     2221 ccctgataaa tgcttcaata atattgaaaa aggaagagtc ctgaggcgga aagaaccagc

     2281 tgtggaatgt gtgtcagtta gggtgtggaa agtccccagg ctccccagca ggcagaagta

     2341 tgcaaagcat gcatctcaat tagtcagcaa ccaggtgtgg aaagtcccca ggctccccag

     2401 caggcagaag tatgcaaagc atgcatctca attagtcagc aaccatagtc ccgcccctaa

     2461 ctccgcccat cccgccccta actccgccca gttccgccca ttctccgccc catggctgac

     2521 taattttttt tatttatgca gaggccgagg ccgcctcggc ctctgagcta ttccagaagt

     2581 agtgaggagg cttttttgga ggcctaggct tttgcaaaga tcgatcaaga gacaggatga

     2641 ggatcgtttc gcatgattga acaagatgga ttgcacgcag gttctccggc cgcttgggtg

     2701 gagaggctat tcggctatga ctgggcacaa cagacaatcg gctgctctga tgccgccgtg

     2761 ttccggctgt cagcgcaggg gcgcccggtt ctttttgtca agaccgacct gtccggtgcc

     2821 ctgaatgaac tgcaagacga ggcagcgcgg ctatcgtggc tggccacgac gggcgttcct

     2881 tgcgcagctg tgctcgacgt tgtcactgaa gcgggaaggg actggctgct attgggcgaa

     2941 gtgccggggc aggatctcct gtcatctcac cttgctcctg ccgagaaagt atccatcatg

     3001 gctgatgcaa tgcggcggct gcatacgctt gatccggcta cctgcccatt cgaccaccaa

     3061 gcgaaacatc gcatcgagcg agcacgtact cggatggaag ccggtcttgt cgatcaggat

     3121 gatctggacg aagagcatca ggggctcgcg ccagccgaac tgttcgccag gctcaaggcg

     3181 agcatgcccg acggcgagga tctcgtcgtg acccatggcg atgcctgctt gccgaatatc

     3241 atggtggaaa atggccgctt ttctggattc atcgactgtg gccggctggg tgtggcggac

     3301 cgctatcagg acatagcgtt ggctacccgt gatattgctg aagagcttgg cggcgaatgg

     3361 gctgaccgct tcctcgtgct ttacggtatc gccgctcccg attcgcagcg catcgccttc

     3421 tatcgccttc ttgacgagtt cttctgagcg ggactctggg gttcgaaatg accgaccaag

     3481 cgacgcccaa cctgccatca cgagatttcg attccaccgc cgccttctat gaaaggttgg

     3541 gcttcggaat cgttttccgg gacgccggct ggatgatcct ccagcgcggg gatctcatgc

     3601 tggagttctt cgcccaccct agggggaggc taactgaaac acggaaggag acaataccgg

     3661 aaggaacccg cgctatgacg gcaataaaaa gacagaataa aacgcacggt gttgggtcgt

     3721 ttgttcataa acgcggggtt cggtcccagg gctggcactc tgtcgatacc ccaccgagac

     3781 cccattgggg ccaatacgcc cgcgtttctt ccttttcccc accccacccc ccaagttcgg

     3841 gtgaaggccc agggctcgca gccaacgtcg gggcggcagg ccctgccata gcctcaggtt

     3901 actcatatat actttagatt gatttaaaac ttcattttta atttaaaagg atctaggtga

     3961 agatcctttt tgataatctc atgaccaaaa tcccttaacg tgagttttcg ttccactgag

     4021 cgtcagaccc cgtagaaaag atcaaaggat cttcttgaga tccttttttt ctgcgcgtaa

     4081 tctgctgctt gcaaacaaaa aaaccaccgc taccagcggt ggtttgtttg ccggatcaag

     4141 agctaccaac tctttttccg aaggtaactg gcttcagcag agcgcagata ccaaatactg

     4201 ttcttctagt gtagccgtag ttaggccacc acttcaagaa ctctgtatca ccgcctacat

     4261 acctcgctct gctaatcctg ttaccagtgg ctgctgccag tggcgataag tcgtgtctta

     4321 ccgggttgga ctcaagacga tagttaccgg ataaggcgca gcggtcgggc tgaacggggg

     4381 gttcgtgcac acagcccagc ttggagcgaa cgacctacac cgaactgaga tacctacagc

     4441 gtgagctatg agaaagcgcc acgcttcccg aagggagaaa ggcggacagg tatccggtaa

     4501 gcggcagggt cggaacagga gagcgcacga gggagcttcc agggggaaac gcctggtatc

     4561 tttatagtcc tgtcgggttt cgccacctct gacttgagcg tcgatttttg tgatgctcgt

     4621 caggggggcg gagcctatgg aaaaacgcca gcaacgcggc ctttttacgg ttcctggcct

     4681 tttgctggcc ttttgctcac atgttctttc ctgcgttatc ccctgattct gtggataacc

     4741 gtattaccgc catgcat



1.  This product is FOR RESEARCH USE ONLY!
2.  The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid.


Search name

pDsRed2-ER,Plasmid pDsRed2-ER,pDsRed2-ER vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
