

  • Model: PVT1216
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT1216  2ug


pDsRed2-Mito Information

Promoter: CMV promoter

Replicator: pUC ori, F1 ori

Terminator: SV40 poly (A) signal

Plasmid classification: lactation serial plasmids; lactating fluorescent plasmids; lactating red plasmids

Plasmid size: 4715bp

Plasmid label: N-DsRed2

Prokaryotic resistance: kanamycin Kan (50 mu g/ml)

Screening markers: neomycin Neo/G418

Cloned strains of Escherichia coli, DH5 A and other Escherichia coli

Culture conditions: 37 centigrade, aerobic LB

Expression host: mammalian cells such as 293T

Culture conditions: 37 C, 5%CO2

Induction mode: no induction, instantaneous expression

5'sequencing primers: CMV-F (CGCAAATGGGCGGTAGGCGTG)

3'sequencing primers: SV40-polyA-R (GAAATTTGTGATGCTATTGC)

Remarks: the red fluorescent localization plasmid of mammalian mitochondria


pDsRed2-Mito Description

PDsRed2-Mito is a mitochondrial localization plasmid of mammalian cells, which contains the mitochondrial targeting sequence of the codon optimized red fluorescent protein gene DsRed2 and human cytochrome c oxidase (Mito) subunit VIII.

pDsRed2-Mito is a mammalian expression vector that encodes a fusion of Discosoma sp. Red fluorescent protein (DsRed2; 1, 2) and the mitochondrial targeting sequence from subunit VIII of human cytochrome c oxidase (Mito; 3, 4). The Mito sequence is fused to the 5'-end of DsRed2, a human codon-optimized DsRed variant that is engineered for faster maturation and lower nonspecific aggregation (1, 5). The Mito sequence targets the Mito-DsRed2 fusion protein to the host cell’s mitochondria. To drive expression of Mito-DsRed2, this vector contains the immmediate early promoter of cytomegalovirus (PCMV IE ). SV40 polyadenylation signals downstream of the DsRed2 gene direct proper processing of the 3'-end of the Mito-DsRed2 mRNA. This vector also contains an SV40 origin for replication in any mammalian cell line that expresses the SV40 T-antigen, a pUC origin of replication for propagation in E. coli, and an f1 origin for single-stranded DNA production. A neomycin resistance cassette—consisting of the SV40 early promoter (PSV40e), the neomycin/kanamycin resistance gene of Tn5 (Neor/Kanr), and polyadenylation signals from the herpes simplex virus thymidine kinase (HSV TK poly A) gene—allow stably transfected eukaryotic cells to be selected using G418 (6). A bacterial promoter (P) upstream of this cassette drives expression of the gene encoding kanamycin resistance in E. coli. pDsRed2-Mito is designed for fluorescent labeling of mitochondria. The vector can be introduced into mammalian cells using any standard transfection method. If required, stable transformants can be selected using G418 (6). The Mito-DsRed2 fusion (excitation/emission maxima: 558 nm/583 nm) can be detected by fluorescence microscopy and by flow cytometry. Filter sets optimized for detecting DsRed by microscopy are available from Chroma Technology Corporation and Omega Optical Inc. Please see their websites (www.chroma.com and www.omegafilters.com) and the Living Colors® Vol. II User Manual, provided with this vector, for more information. To detect MitoDsRed2-expressing cells by flow cytometry, use the instrument’s argon-ion laser to excite the fluorophore at 488 nm and the FL-2 channel to detect the fluorophore’s emission at 583 nm.



pDsRed2-Mito Sequence

LOCUS       Exported                4715 bp ds-DNA    circular SYN 02-8-2017

KEYWORDS    pDsRed2-Mito

SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 4715)

  TITLE     Direct Submission

  JOURNAL   Exported 2017-8-2

FEATURES             Location/Qualifiers

     source          1..4715

                     /organism="synthetic DNA construct"

                     /mol_type="other DNA"

     enhancer        61..364

                     /note="CMV enhancer"

                     /note="human cytomegalovirus immediate early enhancer"

     promoter        365..568

                     /note="CMV promoter"

                     /note="human cytomegalovirus (CMV) immediate early 


     misc_feature    597..683


     CDS             705..1382


                     /product="improved tetrameric variant of DsRed fluorescent 



                     /note="mammalian codon-optimized"






     polyA_signal    1503..1624

                     /note="SV40 poly(A) signal"

                     /note="SV40 polyadenylation signal"

     rep_origin      complement(1631..2086)


                     /note="f1 ori"

                     /note="f1 bacteriophage origin of replication; arrow 

                     indicates direction of (+) strand synthesis"

     promoter        2113..2217


                     /note="AmpR promoter"

     promoter        2219..2576

                     /note="SV40 promoter"

                     /note="SV40 enhancer and early promoter"

     rep_origin      2427..2562

                     /note="SV40 ori"

                     /note="SV40 origin of replication"

     CDS             2611..3405


                     /gene="aph(3')-II (or nptII)"

                     /product="aminoglycoside phosphotransferase from Tn5"


                     /note="confers resistance to neomycin, kanamycin, and G418 







     polyA_signal    3637..3684

                     /note="HSV TK poly(A) signal"

                     /note="herpes simplex virus thymidine kinase 

                     polyadenylation signal (Cole and Stacy, 1985)"

     rep_origin      4013..4601



                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 



        1 tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata tggagttccg

       61 cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt

      121 gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc attgacgtca

      181 atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt atcatatgcc

      241 aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt atgcccagta

      301 catgacctta tgggactttc ctacttggca gtacatctac gtattagtca tcgctattac

      361 catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg actcacgggg

      421 atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc aaaatcaacg

      481 ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg gtaggcgtgt

      541 acggtgggag gtctatataa gcagagctgg tttagtgaac cgtcagatcc gctagcatgt

      601 ccgtcctgac gccgctgctg ctgcggggct tgacaggctc ggcccggcgg ctcccagtgc

      661 cgcgcgccaa gatccattcg ttgggggatc caccggtcgc caccatggcc tcctccgaga

      721 acgtcatcac cgagttcatg cgcttcaagg tgcgcatgga gggcaccgtg aacggccacg

      781 agttcgagat cgagggcgag ggcgagggcc gcccctacga gggccacaac accgtgaagc

      841 tgaaggtgac caagggcggc cccctgccct tcgcctggga catcctgtcc ccccagttcc

      901 agtacggctc caaggtgtac gtgaagcacc ccgccgacat ccccgactac aagaagctgt

      961 ccttccccga gggcttcaag tgggagcgcg tgatgaactt cgaggacggc ggcgtggcga

     1021 ccgtgaccca ggactcctcc ctgcaggacg gctgcttcat ctacaaggtg aagttcatcg

     1081 gcgtgaactt cccctccgac ggccccgtga tgcagaagaa gaccatgggc tgggaggcct

     1141 ccaccgagcg cctgtacccc cgcgacggcg tgctgaaggg cgagacccac aaggccctga

     1201 agctgaagga cggcggccac tacctggtgg agttcaagtc catctacatg gccaagaagc

     1261 ccgtgcagct gcccggctac tactacgtgg acgccaagct ggacatcacc tcccacaacg

     1321 aggactacac catcgtggag cagtacgagc gcaccgaggg ccgccaccac ctgttcctgt

     1381 agcggccgcg actctagatc ataatcagcc ataccacatt tgtagaggtt ttacttgctt

     1441 taaaaaacct cccacacctc cccctgaacc tgaaacataa aatgaatgca attgttgttg

     1501 ttaacttgtt tattgcagct tataatggtt acaaataaag caatagcatc acaaatttca

     1561 caaataaagc atttttttca ctgcattcta gttgtggttt gtccaaactc atcaatgtat

     1621 cttaaggcgt aaattgtaag cgttaatatt ttgttaaaat tcgcgttaaa tttttgttaa

     1681 atcagctcat tttttaacca ataggccgaa atcggcaaaa tcccttataa atcaaaagaa

     1741 tagaccgaga tagggttgag tgttgttcca gtttggaaca agagtccact attaaagaac

     1801 gtggactcca acgtcaaagg gcgaaaaacc gtctatcagg gcgatggccc actacgtgaa

     1861 ccatcaccct aatcaagttt tttggggtcg aggtgccgta aagcactaaa tcggaaccct

     1921 aaagggagcc cccgatttag agcttgacgg ggaaagccgg cgaacgtggc gagaaaggaa

     1981 gggaagaaag cgaaaggagc gggcgctagg gcgctggcaa gtgtagcggt cacgctgcgc

     2041 gtaaccacca cacccgccgc gcttaatgcg ccgctacagg gcgcgtcagg tggcactttt

     2101 cggggaaatg tgcgcggaac ccctatttgt ttatttttct aaatacattc aaatatgtat

     2161 ccgctcatga gacaataacc ctgataaatg cttcaataat attgaaaaag gaagagtcct

     2221 gaggcggaaa gaaccagctg tggaatgtgt gtcagttagg gtgtggaaag tccccaggct

     2281 ccccagcagg cagaagtatg caaagcatgc atctcaatta gtcagcaacc aggtgtggaa

     2341 agtccccagg ctccccagca ggcagaagta tgcaaagcat gcatctcaat tagtcagcaa

     2401 ccatagtccc gcccctaact ccgcccatcc cgcccctaac tccgcccagt tccgcccatt

     2461 ctccgcccca tggctgacta atttttttta tttatgcaga ggccgaggcc gcctcggcct

     2521 ctgagctatt ccagaagtag tgaggaggct tttttggagg cctaggcttt tgcaaagatc

     2581 gatcaagaga caggatgagg atcgtttcgc atgattgaac aagatggatt gcacgcaggt

     2641 tctccggccg cttgggtgga gaggctattc ggctatgact gggcacaaca gacaatcggc

     2701 tgctctgatg ccgccgtgtt ccggctgtca gcgcaggggc gcccggttct ttttgtcaag

     2761 accgacctgt ccggtgccct gaatgaactg caagacgagg cagcgcggct atcgtggctg

     2821 gccacgacgg gcgttccttg cgcagctgtg ctcgacgttg tcactgaagc gggaagggac

     2881 tggctgctat tgggcgaagt gccggggcag gatctcctgt catctcacct tgctcctgcc

     2941 gagaaagtat ccatcatggc tgatgcaatg cggcggctgc atacgcttga tccggctacc

     3001 tgcccattcg accaccaagc gaaacatcgc atcgagcgag cacgtactcg gatggaagcc

     3061 ggtcttgtcg atcaggatga tctggacgaa gagcatcagg ggctcgcgcc agccgaactg

     3121 ttcgccaggc tcaaggcgag catgcccgac ggcgaggatc tcgtcgtgac ccatggcgat

     3181 gcctgcttgc cgaatatcat ggtggaaaat ggccgctttt ctggattcat cgactgtggc

     3241 cggctgggtg tggcggaccg ctatcaggac atagcgttgg ctacccgtga tattgctgaa

     3301 gagcttggcg gcgaatgggc tgaccgcttc ctcgtgcttt acggtatcgc cgctcccgat

     3361 tcgcagcgca tcgccttcta tcgccttctt gacgagttct tctgagcggg actctggggt

     3421 tcgaaatgac cgaccaagcg acgcccaacc tgccatcacg agatttcgat tccaccgccg

     3481 ccttctatga aaggttgggc ttcggaatcg ttttccggga cgccggctgg atgatcctcc

     3541 agcgcgggga tctcatgctg gagttcttcg cccaccctag ggggaggcta actgaaacac

     3601 ggaaggagac aataccggaa ggaacccgcg ctatgacggc aataaaaaga cagaataaaa

     3661 cgcacggtgt tgggtcgttt gttcataaac gcggggttcg gtcccagggc tggcactctg

     3721 tcgatacccc accgagaccc cattggggcc aatacgcccg cgtttcttcc ttttccccac

     3781 cccacccccc aagttcgggt gaaggcccag ggctcgcagc caacgtcggg gcggcaggcc

     3841 ctgccatagc ctcaggttac tcatatatac tttagattga tttaaaactt catttttaat

     3901 ttaaaaggat ctaggtgaag atcctttttg ataatctcat gaccaaaatc ccttaacgtg

     3961 agttttcgtt ccactgagcg tcagaccccg tagaaaagat caaaggatct tcttgagatc

     4021 ctttttttct gcgcgtaatc tgctgcttgc aaacaaaaaa accaccgcta ccagcggtgg

     4081 tttgtttgcc ggatcaagag ctaccaactc tttttccgaa ggtaactggc ttcagcagag

     4141 cgcagatacc aaatactgtt cttctagtgt agccgtagtt aggccaccac ttcaagaact

     4201 ctgtagcacc gcctacatac ctcgctctgc taatcctgtt accagtggct gctgccagtg

     4261 gcgataagtc gtgtcttacc gggttggact caagacgata gttaccggat aaggcgcagc

     4321 ggtcgggctg aacggggggt tcgtgcacac agcccagctt ggagcgaacg acctacaccg

     4381 aactgagata cctacagcgt gagctatgag aaagcgccac gcttcccgaa gggagaaagg

     4441 cggacaggta tccggtaagc ggcagggtcg gaacaggaga gcgcacgagg gagcttccag

     4501 ggggaaacgc ctggtatctt tatagtcctg tcgggtttcg ccacctctga cttgagcgtc

     4561 gatttttgtg atgctcgtca ggggggcgga gcctatggaa aaacgccagc aacgcggcct

     4621 ttttacggtt cctggccttt tgctggcctt ttgctcacat gttctttcct gcgttatccc

     4681 ctgattctgt ggataaccgt attaccgcca tgcat



Product is for research use only!


Search name

pDsRed2-Mito,Plasmid pDsRed2-Mito,pDsRed2-Mito vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
