pEBFP- C1 Plasmid


  • Model: PVT1221
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pEBFP-C1,Plasmid pEBFP-C1,pEBFP-C1 vector



pEBFP-C1 Information

Promoter: CMV promoter

Replicon: pUC ori, F1 ori

Terminator: SV40 poly (A) signal

Plasmid classification: lactation serial plasmid; lactating fluorescent plasmid; lactation blue plasmid.

Plasmid size: 4731bp

Plasmid tagging: N-EBFP

Prokaryotic resistance: kanamycin Kan (50 g/ml)

Screening marker: neomycin (Neomycin) / genetic mycin (Geneticin/G418)

Cloning strains: E. coli DH5 and E.

Culture conditions: 37 C, aerobic, LB

Expression host: mammalian cells such as 293T

Culture conditions: 37 C, 5%CO2

Induction mode: no need to induce, transient expression.

5'sequencing primers: CMV-F (CGCAAATGGGCGGTAGGCGTG)

3'sequencing primers: Sv40-polyA-R (GAAATTTGTGATGCTATTGC)


pEBFP-C1 Description

PEBFP-C1 is a blue fluorescent expression plasmid of mammalian cells. CMV promotes the fusion expression of target gene and blue fluorescent gene EBFP. Blue fluorescence can be observed under fluorescence microscope.


pEBFP-C1 Multiple cloning site



pEBFP-C1 Sequence

LOCUS       Exported                4731 bp ds-DNA     circular SYN 20-SEP-2016
DEFINITION  synthetic circular DNA
KEYWORDS    Untitled
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4731)
  TITLE     Direct Submission
  JOURNAL   Exported Tuesday, September 20, 2016 
FEATURES             Location/Qualifiers
     source          1..4731
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     enhancer        61..364
                     /note="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        365..568
                     /note="CMV promoter"
                     /note="human cytomegalovirus (CMV) immediate early 
     CDS             613..1329
                     /product="enhanced blue variant of GFP"
                     /note="mammalian codon-optimized"
     misc_feature    1330..1395
                     /note="multiple cloning site"
     polyA_signal    1519..1640
                     /note="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     rep_origin      complement(1647..2102)
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow 
                     indicates direction of (+) strand synthesis"
     promoter        2129..2233
                     /note="AmpR promoter"
     promoter        2235..2592
                     /note="SV40 promoter"
                     /note="SV40 enhancer and early promoter"
     rep_origin      2443..2578
                     /note="SV40 ori"
                     /note="SV40 origin of replication"
     CDS             2627..3421
                     /gene="aph(3')-II (or nptII)"
                     /product="aminoglycoside phosphotransferase from Tn5"
                     /note="confers resistance to neomycin, kanamycin, and G418 
     polyA_signal    3653..3700
                     /note="HSV TK poly(A) signal"
                     /note="herpes simplex virus thymidine kinase 
                     polyadenylation signal (Cole and Stacy, 1985)"
     rep_origin      4029..4617
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
        1 tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata tggagttccg
       61 cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt
      121 gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc attgacgtca
      181 atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt atcatatgcc
      241 aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt atgcccagta
      301 catgacctta tgggactttc ctacttggca gtacatctac gtattagtca tcgctattac
      361 catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg actcacgggg
      421 atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc aaaatcaacg
      481 ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg gtaggcgtgt
      541 acggtgggag gtctatataa gcagagctgg tttagtgaac cgtcagatcc gctagcgcta
      601 ccggtcgcca ccatggtgag caagggcgag gagctgttca ccggggtggt gcccatcctg
      661 gtcgagctgg acggcgacgt aaacggccac aagttcagcg tgtccggcga gggcgagggc
      721 gatgccacct acggcaagct gaccctgaag ttcatctgca ccaccggcaa gctgcccgtg
      781 ccctggccca ccctcgtgac caccctgacc cacggcgtgc agtgcttcag ccgctacccc
      841 gaccacatga agcagcacga cttcttcaag tccgccatgc ccgaaggcta cgtccaggag
      901 cgcaccatct tcttcaagga cgacggcaac tacaagaccc gcgccgaggt gaagttcgag
      961 ggcgacaccc tggtgaaccg catcgagctg aagggcatcg acttcaagga ggacggcaac
     1021 atcctggggc acaagctgga gtacaacttc aacagccaca acgtctatat catggccgac
     1081 aagcagaaga acggcatcaa ggtgaacttc aagatccgcc acaacatcga ggacggcagc
     1141 gtgcagctcg ccgaccacta ccagcagaac acccccatcg gcgacggccc cgtgctgctg
     1201 cccgacaacc actacctgag cacccagtcc gccctgagca aagaccccaa cgagaagcgc
     1261 gatcacatgg tcctgctgga gttcgtgacc gccgccggga tcactctcgg catggacgag
     1321 ctgtacaagt ccggactcag atctcgagct caagcttcga attctgcagt cgacggtacc
     1381 gcgggcccgg gatccaccgg atctagataa ctgatcataa tcagccatac cacatttgta
     1441 gaggttttac ttgctttaaa aaacctccca cacctccccc tgaacctgaa acataaaatg
     1501 aatgcaattg ttgttgttaa cttgtttatt gcagcttata atggttacaa ataaagcaat
     1561 agcatcacaa atttcacaaa taaagcattt ttttcactgc attctagttg tggtttgtcc
     1621 aaactcatca atgtatctta acgcgtaaat tgtaagcgtt aatattttgt taaaattcgc
     1681 gttaaatttt tgttaaatca gctcattttt taaccaatag gccgaaatcg gcaaaatccc
     1741 ttataaatca aaagaataga ccgagatagg gttgagtgtt gttccagttt ggaacaagag
     1801 tccactatta aagaacgtgg actccaacgt caaagggcga aaaaccgtct atcagggcga
     1861 tggcccacta cgtgaaccat caccctaatc aagttttttg gggtcgaggt gccgtaaagc
     1921 actaaatcgg aaccctaaag ggagcccccg atttagagct tgacggggaa agccggcgaa
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
