pEBFP- N1 Plasmid


  • Model: PVT1220
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pEBFP-N1,Plasmid pEBFP-N1,pEBFP-N1 vector

pEBFP-N1 plasmid information

Promoter: CMV
Replicon: pUC ori, F1 ori
Terminator: SV40 poly (A) signal
Plasmid classification: mammalian cells, fluorescent protein reporter vectors
Plasmid size: 4733bp
Prokaryotic resistance: Kan
Selection marker: Neo
Clone strain: DH5 alpha
Culture conditions: 37 LB, aerobic
Expression host: mammalian cells
Induction method: no induction, transient expression
Primers for 5'sequencing: CMV-F:CGCAAATGGGCGGTAGGCGTG
Primers for 3'sequencing: primers were designed according to the sequence

pEBFP-N1 plasmid description
 pEBFP-N1 carries a blue fluorescent variant of the Aequorea victoria green fluorescent protein gene (GFP). The EBFP gene contains four amino acid substitutions. The Tyr-66 to His substitution gives EBFP fluorescence excitation and emission maxima (380 and 440 nm, respectively) similar to other blue emission variants (1–3). The other three substitutions (Phe-64 to Leu; Ser-65 to Thr; and Tyr- 145 to Phe) enhance the brightness and solubility of the protein, primarily due to improved proteinfolding properties and efficiency of chromophore formation (1, 4, 5). The Em of EBFP is 31,000 cm–1M–1 for 380-nm excitation, leading to a fluorescent signal that is 2–3-fold brighter than other blue variants of GFP and roughly equivalent to wt GFP. In addition, the rate of photobleaching of EBFP is one-half to one-third that of P4-3, a popular predecessor to EBFP (1). EBFP contains >190 silent mutations that create an open reading frame comprised almost entirely of preferred human codons (6). Furthermore, upstream sequences flanking EBFP have been converted to a Kozak consensus translation initiation site (7). These changes increase the translational efficiency of the EBFP mRNA and consequently the expression of EBFP in mammalian and plant cells.


pEBFP-N1 plasmid sequence

LOCUS       Exported                4733 bp ds-DNA    circular SYN 19-10-2015
KEYWORDS    Untitled 3
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4733)
  AUTHORS   admin
  TITLE     Direct Submission
  JOURNAL   Exported 2015-10-19  
FEATURES             Location/Qualifiers
     source          1..4733
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     enhancer        61..364
                     /note="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        365..568
                     /note="CMV promoter"
                     /note="human cytomegalovirus (CMV) immediate early 
     misc_feature    591..671
                     /note="multiple cloning site"
     CDS             679..1398
                     /product="enhanced GFP"
                     /note="mammalian codon-optimized"
     polyA_signal    1521..1642
                     /note="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     rep_origin      complement(1649..2104)
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow 
                     indicates direction of (+) strand synthesis"
     promoter        2131..2235
                     /note="AmpR promoter"
     promoter        2237..2594
                     /note="SV40 promoter"
                     /note="SV40 enhancer and early promoter"
     rep_origin      2445..2580
                     /note="SV40 ori"
                     /note="SV40 origin of replication"
     CDS             2629..3423
                     /gene="aph(3')-II (or nptII)"
                     /product="aminoglycoside phosphotransferase from Tn5"
                     /note="confers resistance to neomycin, kanamycin, and G418 
     polyA_signal    3655..3702
                     /note="HSV TK poly(A) signal"
                     /note="herpesvirus thymidine kinase polyadenylation signal"
     rep_origin      4031..4619
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
        1 tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata tggagttccg
       61 cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt
      121 gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc attgacgtca
      181 atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt atcatatgcc
      241 aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt atgcccagta
      301 catgacctta tgggactttc ctacttggca gtacatctac gtattagtca tcgctattac
      361 catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg actcacgggg
      421 atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc aaaatcaacg
      481 ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg gtaggcgtgt
      541 acggtgggag gtctatataa gcagagctgg tttagtgaac cgtcagatcc gctagcgcta
      601 ccggactcag atctcgagct caagcttcga attctgcagt cgacggtacc gcgggcccgg
      661 gatccaccgg tcgccaccat ggtgagcaag ggcgaggagc tgttcaccgg ggtggtgccc
      721 atcctggtcg agctggacgg cgacgtaaac ggccacaagt tcagcgtgtc cggcgagggc
      781 gagggcgatg ccacctacgg caagctgacc ctgaagttca tctgcaccac cggcaagctg
      841 cccgtgccct ggcccaccct cgtgaccacc ctgacctacg gcgtgcagtg cttcagccgc
      901 taccccgacc acatgaagca gcacgacttc ttcaagtccg ccatgcccga aggctacgtc
      961 caggagcgca ccatcttctt caaggacgac ggcaactaca agacccgcgc cgaggtgaag
     1021 ttcgagggcg acaccctggt gaaccgcatc gagctgaagg gcatcgactt caaggaggac
     1081 ggcaacatcc tggggcacaa gctggagtac aactacaaca gccacaacgt ctatatcatg
     1141 gccgacaagc agaagaacgg catcaaggtg aacttcaaga tccgccacaa catcgaggac
     1201 ggcagcgtgc agctcgccga ccactaccag cagaacaccc ccatcggcga cggccccgtg
     1261 ctgctgcccg acaaccacta cctgagcacc cagtccgccc tgagcaaaga ccccaacgag
     1321 aagcgcgatc acatggtcct gctggagttc gtgaccgccg ccgggatcac tctcggcatg
     1381 gacgagctgt acaagtaaag cggccgcgac tctagatcat aatcagccat accacatttg
     1441 tagaggtttt acttgcttta aaaaacctcc cacacctccc cctgaacctg aaacataaaa
     1501 tgaatgcaat tgttgttgtt aacttgttta ttgcagctta taatggttac aaataaagca
     1561 atagcatcac aaatttcaca aataaagcat ttttttcact gcattctagt tgtggtttgt
     1621 ccaaactcat caatgtatct taaggcgtaa attgtaagcg ttaatatttt gttaaaattc
     1681 gcgttaaatt tttgttaaat cagctcattt tttaaccaat aggccgaaat cggcaaaatc
     1741 ccttataaat caaaagaata gaccgagata gggttgagtg ttgttccagt ttggaacaag
     1801 agtccactat taaagaacgt ggactccaac gtcaaagggc gaaaaaccgt ctatcagggc
     1861 gatggcccac tacgtgaacc atcaccctaa tcaagttttt tggggtcgag gtgccgtaaa
     1921 gcactaaatc ggaaccctaa agggagcccc cgatttagag cttgacgggg aaagccggcg
     1981 aacgtggcga gaaaggaagg gaagaaagcg aaaggagcgg gcgctagggc gctggcaagt
     2041 gtagcggtca cgctgcgcgt aaccaccaca cccgccgcgc ttaatgcgcc gctacagggc
     2101 gcgtcaggtg gcacttttcg gggaaatgtg cgcggaaccc ctatttgttt atttttctaa
     2161 atacattcaa atatgtatcc gctcatgaga caataaccct gataaatgct tcaataatat
     2221 tgaaaaagga agagtcctga ggcggaaaga accagctgtg gaatgtgtgt cagttagggt
     2281 gtggaaagtc cccaggctcc ccagcaggca gaagtatgca aagcatgcat ctcaattagt
     2341 cagcaaccag gtgtggaaag tccccaggct ccccagcagg cagaagtatg caaagcatgc
     2401 atctcaatta gtcagcaacc atagtcccgc ccctaactcc gcccatcccg cccctaactc
     2461 cgcccagttc cgcccattct ccgccccatg gctgactaat tttttttatt tatgcagagg
     2521 ccgaggccgc ctcggcctct gagctattcc agaagtagtg aggaggcttt tttggaggcc
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
