pEC- XK99E

$260.00

  • Model: PVT11362
  • 48 Units in Stock
Ask a question


Add to Cart:

pEC-XK99E


Catalog No. PVT11362
Packing 2ug

 

pEC-XK99E Information
Function /
Resistance Kan
Screen /
Strain DH5α
Culture temperature LB 37℃
Replicon
Copy
Promoter
Induction
Forward primer
Reverse primer

pEC-XK99E Sequence

gaattcgagctcggtacccggggatcctctagagtcgacctgcaggcatgcaagcttggctgttttggcggatgagagaa
gattttcagcctgatacagattaaatcagaacgcagaagcggtctgataaaacagaatttgcctggcggcagtagcgcgg
tggtcccacctgaccccatgccgaactcagaagtgaaacgccgtagcgccgatggtagtgtggggtctccccatgcgaga
gtagggaactgccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcgg
tgaacgctctcctgagtaggacaaatccgccgggagcggatttgaacgttgcgaagcaacggcccggagggtggcgggca
ggacgcccgccataaactgccaggcatcaaattaagcagaaggccatcctgacggatggcctttttgcgtttctacaaac
tctttttgtttatttttctaaatacattcaaatatgtatccgctcatgaattaattccgctagatgacgtgcggcttcga
cctcctgggcgtggcgcttgttggcgcgctcgcggctggctgcggcacgacacgcgtctgagcagtattttgcgcgccgt
cctcgtgggtcaggccggggtgggatcaggccaccgcagtaggcgcagctgatgcgatcctccactactgcgcgtcctcc
tggcgctgccgagcacgcagctcgtcggccagctcttcaaggtcggccacaagcgtttctaggtcgctcgcggcacttgc
ccagtcgcgtgatgctggcgcgtctgtcgtatcgagggcgcggaaaaatccgatcaccgtttttaaatcgacggcggcat
cgagtgcgtcggactccagcgcgacatcggagagatccaccgctgatgcttcaggccagttttggtacttcgtcgtgaag
gtcatgacaccattataacgaacgttcgttaaaaattctagccccaattctgataatttcttccggcactcctgcgaaaa
cctgcgagacttcttgcccagaaaaaacgccaagcgcagcggttaccgcactttttttccaggtgatttcaccctgacca
gcgaagcggcactttagtgcatgaggtgtgcccctggtttcccctctttggagggttcaacccaaaaaagcacacaagca
aaaatgaaaatcatcatgagcaagttggtgcgaagcagcaacgcgctagctccaaaaaggtctccaggatctcgaggaga
tttttgagggggagggagtcgaggaagagccagagcagaaggcggggaaccgttctctgccgacagcgtgagcccccctt
aaaaatcaggccggggaggaaccggggagggatcagagctaggagcgagacaccctaaagggggggaaccgttttctgct
gacggtgtttcgtttattagttttcagcccgtggatagcggagggtgagggcaagtgagagccagagcaaggacgggacc
cctaaaggggggaaccgttttctgctgacggtgtttcgtttattagttttcagcccgtggacggccgcgtttagcttcca
ttccaagtgcctttctgacttgttggatgcgcctttcactgacacctagttcgcctgcaagctcacgagtcgagggatca
gcaaccgattgagaacgggcatccaggatcgcagttttgacgcgaagttcgagcaactcgcctgtcatttctcggcgttt
gtttgcttccgctaatcgctgtcgcgtctcctgcgcatacttactttctgggtcagcccatctgcgtgcattcgatgtag
ctgcgccccgtcgccccatcgtcgctagagctttccgccctcggctgctctgcgtttccacccgacgagcagggacgact
ggctggcctttagccacgtagccgcgcacacgacgcgccatcgtcaggcgatcacgcatggcgggaagatccggctcccg
gccgtctgcaccgaccgcctgggcaacgttgtacgccacttcatacgcgtcgatgatcttggcatcttttaggcgctcac
cagcagctttgagctggtatcccacggtcaacgcgtggcgaaacgcggtctcgtcgcgcgctcgctctggatttgtccag
agcactcgcacgccgtcgatcaggtcgccggacgcgtccagggcgctcggcaggctcgcgtccaaaatcgctagcgcctt
ggcttctgcggtggcgcgttgtgccgcttcaatgcgggcgcgtccgctggaaaagtcctgctcaatgtactttttcggct
tctgtgatccggtcatcgttcgagcaatctccattaggtcggccagccgatccacacgatcatgctggcagtgccattta
taggctgtcggatcgtctgagacgtgcagcggccaccggctcagcctatgcgaaaaagcctggtcagcgccgaaaacacg
agtcatttcttccgtcgttgcagccagcaggcgcatatttgggctggttttacctgctgcggcatacaccgggtcaatga
gccagatgagctggcatttcccgctcagcggattcacgccgatccaagccggcgctttttctaggcgtgcccatttctct
aaaatcgcgtagacctgcgggtttacgtgctcaatcttcccgccggcctggtggctgggcacatcgatgtcaagcacgat
caccgcggcatgttgcgcgtgcgtcagcgcaacgtactggcaccgcgtcagcgcttttgagccagcccggtagagctttg
gttgggtttcgccggtatccgggtttttaatccaggcgctcgcgaaatctcttgtcttgctgccctggaagctttcgcgt
cccaggtgagcgagcagttcgcggcgatcttctgccgtccagccgcgtgagccgcagcgcatagcttcggggtgggtgtc
gaacagatcggcggacaatttccacgcgctagctgtgactgtgtcctgcggatcggctagagtcatgtcttgagtgcttt
ctcccagctgatgactgggggttagccgacgccctgtgagttcccgctcacggggcgttcaactttttcaggtatttgtg
cagcttatcgtgttttcttcgtaaatgaacgcttaactaccttgttaaacgtggcaaataggcaggattgatggggatct
agcttcacgctgccgcaagcactcagggcgcaagggctgctaaaggaagcggaacacgtagaaagccagtccgcagaaac
ggtgctgaccccggatgaatgtcagctactgggctatctggacaagggaaaacgcaagcgcaaagagaaagcaggtagct
tgcagtgggcttacatggcgatagctagactgggcggttttatggacagcaagcgaaccggaattgccagctggggcgcc
ctctggtaaggttgggaagccctgcaaagtaaactggatggctttcttgccgccaaggatctgatggcgcaggggatcaa
gatctgatcaagagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggttctccggccgcttgg
gtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgca
ggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactccaagacgaggcagcgcggctatcgt
ggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggc
gaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcg
gctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatgg
aagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaag
gcgcggatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccg
cttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattg
ctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgcc
ttctatcgccttcttgacgagttcttctgagcgggactctggggttcgcggaatcatgaccaaaatcccttaacgtgagt
tttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgc
tgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggt
aactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctg
tagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccggg
ttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttgga
gcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcgg
acaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttat
agtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaa
cgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctg
attctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtca
gtgagcgaggaagcggaagagcgcctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatggtg
cactctcagtacaatctgctctgatgccgcatagttaagccagtatacactccgctatcgctacgtgactgggtcatggc
tgcgccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctg
tgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgaggcagcagatcaattcgcgc
gcgaaggcgaagcggcatgcatttacgttgacaccatcgaatggtgcaaaacctttcgcggtatggcatgatagcgcccg
gaagagagtcaattcagggtggtgaatgtgaaaccagtaacgttatacgatgtcgcagagtatgccggtgtctcttatca
gaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggcgatggcggagc
tgaattacattcccaaccgcgtggcacaacaactggcgggcaaacagtcgttgctgattggcgttgccacctccagtctg
gccctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtggtggtgtcgat
ggtagaacgaagcggcgtcgaagcctgtaaagcggcggtgcacaatcttctcgcgcaacgcgtcagtgggctgatcatta
actatccgctggatgaccaggatgccattgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctct
gaccagacacccatcaacagtattattttctcccatgaagacggtacgcgactgggcgtggagcatctggtcgcattggg
tcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgcgtctggctggctggcataaatatc
tcactcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaa
atgctgaatgagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatgcgcgccattac
cgagtccgggctgcgcgttggtgcggatatctcggtagtgggatacgacgataccgaagacagctcatgttatatcccgc
cgtcaaccaccatcaaacaggattttcgcctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccag
gcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaatacgcaaaccgcctc
tccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgca
attaatgtgagttagcgcgaattgatctggtttgacagcttatcatcgactgcacggtgcaccaatgcttctggcgtcag
gcagccatcggaagctgtggtatggctgtgcaggtcgtaaatcactgcataattcgtgtcgctcaaggcgcactcccgtt
ctggataatgttttttgcgccgacatcataacggttctggcaaatattctgaaatgagctgttgacaattaatcatccgg
ctcgtataatgtgtggaattgtgagcggataacaatttcacacaggaaacagaccatg
//


Caution:
Product is for research use only!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart