pECMV- 3*Flag- HMGB1- m


  • Model: PVT10464
  • 50 Units in Stock
Ask a question

Add to Cart:


Search Name 

pECMV-3*Flag-HMGB1-m,pECMV-3*Flag-HMGB1-m vector, pECMV-3*Flag-HMGB1-m plasmid, pECMV-3*Flag-HMGB1-m map


pECMV-3*Flag-HMGB1-m Informaiton

Promoter: ECMV promoter

Replicator: pUC ori, F1 ori, SV40 ori

Terminator: bGH poly (A) signal

Plasmid classification: gene library plasmid, mouse gene plasmid, mouse eukaryotic plasmid.

Plasmid size: 6100bp

Plasmid label: N-3 x FLAG

Prokaryotic resistance: Amp (100 mu g/ml)

Screening markers: Neo

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, LB, aerobic

Expression host: mammalian cells such as 293T

Culture conditions: 37 C, 5%CO2

Induction mode: no induction

5'sequencing primers: CMV-F (CGCAAATGGGCGGTAGGCGTG)

3'sequencing primers: BGH-R (TAGAAGGCACAGTCGAGG)


pECMV-3*Flag-HMGB1-m Description

The pECMV-3 * FLAG-HMGB1-m plasmid was transformed on the basis of pECMV-3 x FLAG vector. CMV started the overexpression of HMGB1 gene in the mouse source, and the 3 x FLAG fusion label on the N end could be recognized by the FLAG antibody. The plasmid can be directly transfected into mammalian cells as an overexpression plasmid. The plasmid itself has a Neo selection marker, and G418 can be used to screen stable transfected cell lines after transfection.

Gene information from NCBI

Mus musculus high mobility group box 1 (Hmgb1), transcript variant 1, mRNA;NCBI Reference Sequence: NM_001313894.1


pECMV-3*Flag-HMGB1-m Sequence

LOCUS       Exported                6100 bp ds-DNA    circular SYN 10-七月-2017
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 6100)
  AUTHORS   liutao
  TITLE     Direct Submission
  JOURNAL   Exported 2017-7-10
FEATURES             Location/Qualifiers
     source          1..6100
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     enhancer        235..614
                     /note="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        615..818
                     /note="CMV promoter"
                     /note="human cytomegalovirus (CMV) immediate early
     promoter        863..881
                     /note="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     CDS             922..987
                     /product="three tandem FLAG(R) epitope tags, followed by an
                     enterokinase cleavage site"
     misc_feature    1009..1656
     polyA_signal    1700..1924
                     /note="bGH poly(A) signal"
                     /note="bovine growth hormone polyadenylation signal"
     rep_origin      1970..2398
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     promoter        2412..2741
                     /note="SV40 promoter"
                     /note="SV40 enhancer and early promoter"
     rep_origin      2592..2727
                     /note="SV40 ori"
                     /note="SV40 origin of replication"
     CDS             2808..3602
                     /gene="aph(3')-II (or nptII)"
                     /product="aminoglycoside phosphotransferase from Tn5"
                     /note="confers resistance to neomycin, kanamycin, and G418
     polyA_signal    3776..3897
                     /note="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     rep_origin      complement(4348..4933)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     CDS             complement(5104..5964)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     promoter        complement(5965..6069)
                     /note="AmpR promoter"
        1 gacggatcgg gagatctccc gatcccctat ggtgcactct cagtacaatc tgctctgatg
       61 ccgcatagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg
      121 cgagcaaaat ttaagctaca acaaggcaag gcttgaccga caattgcatg aagaatctgc
      181 ttagggttag gcgttttgcg ctgcttcgcg atgtacgggc cagatatacg cgttgacatt
      241 gattattgac tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata
      301 tggagttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc
      361 cccgcccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc
      421 attgacgtca atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt
      481 atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt
      541 atgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca
      601 tcgctattac catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg
      661 actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc
      721 aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg
      781 gtaggcgtgt acggtgggag gtctatataa gcagagctct ctggctaact agagaaccca
      841 ctgcttactg gcttatcgaa attaatacga ctcactatag ggagacccaa gctggctagc
      901 gtttaaactt aagccaccat ggactacaaa gaccatgacg gtgattataa agatcatgac
      961 atcgactaca aggatgacga tgacaagctt ggtaccgagc tcggatccat gggcaaagga
     1021 gatcctaaaa agccgagagg caaaatgtcc tcatatgcat tctttgtgca aacttgccgg
     1081 gaggagcaca agaagaagca cccggatgct tctgtcaact tctcagagtt ctccaagaag
     1141 tgctcagaga ggtggaagac catgtctgct aaagaaaagg ggaaatttga agatatggca
     1201 aaggctgaca aggctcgtta tgaaagagaa atgaaaacct acatcccccc caaaggggag
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
