pEE12.4 Plasmid


  • Model: PVT1803
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pEE12.4,Plasmid pEE12.4,pEE12.4 vector

Promoter: hCMV-MIE
Replicator: Pee6 ori
Terminator: SV40, poly (A) signal
Plasmid classification: mammalian cells, antibody expression vectors
Plasmid size: 7569bp
Prokaryotic resistance: Amp
Clone strain: DH5 alpha
Culture conditions: 37 DEG C, aerobic LB
Expression host: mammalian cells
Induction mode: no induction, transient expression
Primers for 5'sequencing: CMV-F:CGCAAATGGGCGGTAGGCGTG
Primers for 3'sequencing: according to sequences


pEE12.4 Sequence

LOCUS       Exported                7569 bp ds-DNA     circular SYN 10-AUG-2017
FEATURES             Location/Qualifiers
     source          1..7569
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     polyA_signal    116..237
                     /label=SV40 poly(A) signal
                     /note="SV40 polyadenylation signal"
     rep_origin      complement(999..1587)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
     CDS             complement(1758..2618)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     promoter        complement(2619..2723)
                     /label=AmpR promoter
     terminator      2892..2919
                     /label=T7Te terminator
                     /note="phage T7 early transcription terminator"
     promoter        3002..3331
                     /label=SV40 promoter
                     /note="SV40 enhancer and early promoter"
     rep_origin      3182..3317
                     /label=SV40 ori
                     /note="SV40 origin of replication"
     intron          4623..4688
                     /label=small t intron
                     /note="simian virus 40 (SV40) small t antigen intron"
     CDS             4818..4838
                     /product="nuclear localization signal of SV40 large T 
                     /label=SV40 NLS
     polyA_signal    5263..5397
                     /label=SV40 poly(A) signal
                     /note="SV40 polyadenylation signal"
     enhancer        5966..6345
                     /label=CMV enhancer
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        6346..6549
                     /label=CMV promoter
                     /note="human cytomegalovirus (CMV) immediate early 
        1 gaattcattg atcataatca gccataccac atttgtagag gttttacttg ctttaaaaaa
       61 cctcccacac ctccccctga acctgaaaca taaaatgaat gcaattgttg ttgttaactt
      121 gtttattgca gcttataatg gttacaaata aagcaatagc atcacaaatt tcacaaataa
      181 agcatttttt tcactgcatt ctagttgtgg tttgtccaaa ctcatcaatg tatcttatca
      241 tgtctggcgg ccgcgacctg caggcgcaga actggtaggt atggaagatc cctcgagatc
      301 cattgtgctg gcggtaggcg agcagcgcct gcctgaagct gcgggcattc ccgatcagaa
      361 atgagcgcca gtcgtcgtcg gctctcggca ccgaatgcgt atgattctcc gccagcatgg
      421 cttcggccag tgcgtcgagc agcgcccgct tgttcctgaa gtgccagtaa agcgccggct
      481 gctgaacccc caaccgttcc gccagtttgc gtgtcgtcag accgtctacg ccgacctcgt
      541 tcaacaggtc cagggcggca cggatcactg tattcggctg caactttgtc atgcttgaca
      601 ctttatcact gataaacata atatgtccac caacttatca gtgataaaga atccgcgcca
      661 gcacaatgga tctcgaggtc gagggatctc tagaggatcc tctacgccgg acgcatcgtg
      721 gccggcatca ccggcgccac aggtgcggtt gctggcgcct atatcgccga catcaccgat
      781 ggggaagatc gggctcgcca cttcgggctc atgagcgctt gtttcggcgt gggtatggtg
      841 gcaggccccg tggccggggg actgttgggc gccatctcct tgcatgcacc attccttgcg
      901 gcggcggtgc tcaacggcct caacctacta ctgggctgct tcctaatgca ggagtcgcat
      961 aagggagagc gtcgacctcg ggccgcgttg ctggcgtttt tccataggct ccgcccccct
     1021 gacgagcatc acaaaaatcg acgctcaagt cagaggtggc gaaacccgac aggactataa
     1081 agataccagg cgtttccccc tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg
     1141 cttaccggat acctgtccgc ctttctccct tcgggaagcg tggcgctttc tcatagctca
     1201 cgctgtaggt atctcagttc ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa
     1261 ccccccgttc agcccgaccg ctgcgcctta tccggtaact atcgtcttga gtccaacccg
     1321 gtaagacacg acttatcgcc actggcagca gccactggta acaggattag cagagcgagg
     1381 tatgtaggcg gtgctacaga gttcttgaag tggtggccta actacggcta cactagaaga
     1441 acagtatttg gtatctgcgc tctgctgaag ccagttacct tcggaaaaag agttggtagc
     1501 tcttgatccg gcaaacaaac caccgctggt agcggtggtt tttttgtttg caagcagcag
     1561 attacgcgca gaaaaaaagg atctcaagaa gatcctttga tcttttctac ggggtctgac
     1621 gctcagtgga acgaaaactc acgttaaggg attttggtca tgagattatc aaaaaggatc
     1681 ttcacctaga tccttttaaa ttaaaaatga agttttaaat caatctaaag tatatatgag
     1741 taaacttggt ctgacagtta ccaatgctta atcagtgagg cacctatctc agcgatctgt
     1801 ctatttcgtt catccatagt tgcctgactc cccgtcgtgt agataactac gatacgggag
     1861 ggcttaccat ctggccccag tgctgcaatg ataccgcgag acccacgctc accggctcca
     1921 gatttatcag caataaacca gccagccgga agggccgagc gcagaagtgg tcctgcaact
     1981 ttatccgcct ccatccagtc tattaattgt tgccgggaag ctagagtaag tagttcgcca
     2041 gttaatagtt tgcgcaacgt tgttgccatt gctacaggca tcgtggtgtc acgctcgtcg
     2101 tttggtatgg cttcattcag ctccggttcc caacgatcaa ggcgagttac atgatccccc
     2161 atgttgtgca aaaaagcggt tagctccttc ggtcctccga tcgttgtcag aagtaagttg
     2221 gccgcagtgt tatcactcat ggttatggca gcactgcata attctcttac tgtcatgcca
     2281 tccgtaagat gcttttctgt gactggtgag tactcaacca agtcattctg agaatagtgt
     2341 atgcggcgac cgagttgctc ttgcccggcg tcaatacggg ataataccgc gccacatagc
     2401 agaactttaa aagtgctcat cattggaaaa cgttcttcgg ggcgaaaact ctcaaggatc
     2461 ttaccgctgt tgagatccag ttcgatgtaa cccactcgtg cacccaactg atcttcagca
     2521 tcttttactt tcaccagcgt ttctgggtga gcaaaaacag gaaggcaaaa tgccgcaaaa
     2581 aagggaataa gggcgacacg gaaatgttga atactcatac tcttcctttt tcaatattat
     2641 tgaagcattt atcagggtta ttgtctcatg agcggataca tatttgaatg tatttagaaa
     2701 aataaacaaa taggggttcc gcgcacattt ccccgaaaag tgccacctga cgtctaagaa
     2761 accattatta tcatgacatt aacctataaa aataggcgta tcacgaggcc ctgatggctc
     2821 tttgcggcac ccatcgttcg taatgttccg tggcaccgag gacaaccctc aagagaaaat
     2881 gtaatcacac tggctcacct tcgggtgggc ctttctgcgt ttataaggag acactttatg
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
