pEE6.4 Plasmid

$796.00

  • Model: PVT1802
  • 50 Units in Stock
Ask a question


Add to Cart:

pEE6.4 Plasmid

PVT1802    2ug

 

pEE6.4 Plasmid Information

Promoter: hCMV-MIE

Replicon: pEE6 ori

Terminator: SV40 poly (A) signal

Plasmid classification: mammalian cells, antibody expression vectors

Plasmid size: 5067bp

Prokaryotic resistance: ampicillin Amp

Cloned strain: Escherichia coli DH5 alpha

Culture conditions: 37 centigrade, aerobic, LB

Expression host: mammalian cells

Induction mode: no induction, instantaneous expression

5'sequencing primers: CMV-F:CGCAAATGGGCGGTAGGCGTG

3'sequencing primers: primers designed according to sequence

 

Caution:
Product is for research use only!
 

 

Search name

pEE6.4,Plasmid pEE6.4,pEE6.4 vector

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart