
  • Model: PVT1034
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT1034  2ug

pEF-GFP Information

Promoter: EF-1 alpha promoter

Replicator: ColE1 ori, SV40 ori

Terminator: SV40 poly (A) signal

Plasmid classification: lactation series plasmids; mammalian expression plasmids; pEF series plasmids

Plasmid size: 5051bp

Plasmid label: C-EGFP

Prokaryotic resistance: ampicillin Amp (100 u g/ml)

Cloned strains of Escherichia coli, DH5 A and other Escherichia coli

Culture conditions: 37 centigrade, aerobic, LB

Expression host: mammalian cells such as 293T

Culture conditions: 37 C, 5%CO2

Induction mode: no induction, instantaneous expression

5'sequencing primers: EF-1 alpha -F (GAATTACTTCCACGCCCCTG)

3'sequencing primers: beta -globin-R (ATGTCCTTCCGAGTGAGAGAC)


pEF-GFP Description

PEF-GFP is a high-level expression plasmid in mammalian cells. EF1 promoter promotes the fusion expression of target gene and green fluorescent protein EGFP. There are EcoRI, KpnI, XmaI and SmaI cleavage sites in MCS region, which can be easily cloned into target genes.



pEF-GFP Sequence

LOCUS       Exported                5051 bp ds-DNA     circular SYN 19-SEP-2016
DEFINITION  synthetic circular DNA
KEYWORDS    Untitled 2
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 5051)
  TITLE     Direct Submission
  JOURNAL   Exported 2016-9-19
FEATURES             Location/Qualifiers
     source          1..5051
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     promoter        36..1217
                     /note="EF-1-alpha promoter"
                     /note="strong constitutive promoter for human elongation
                     factor EF-1-alpha"
     intron          266..1208
                     /note="EF-1-alpha intron A"
                     /note="intron upstream of the start codon of human
     CDS             1269..1988
                     /product="enhanced GFP"
                     /note="mammalian codon-optimized"
     polyA_site      2140..2195
                     /note="beta-globin poly(A) signal"
                     /note="rabbit beta-globin polyadenylation signal"
     primer_bind     complement(2554..2570)
                     /note="M13 rev"
                     /note="common sequencing primer, one of multiple similar
     protein_bind    2578..2594
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(2602..2632)
                     /note="lac promoter"
                     /note="promoter for the E. coli lac operon"
     protein_bind    2647..2668
                     /bound_moiety="E. coli catabolite activator protein"
                     /note="CAP binding site"
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     promoter        2727..2922
                     /note="SV40 promoter"
                     /note="SV40 early promoter"
     rep_origin      2773..2908
                     /note="SV40 ori"
                     /note="SV40 origin of replication"
     polyA_signal    2928..3062
                     /note="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     rep_origin      complement(3301..3889)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     CDS             complement(4060..4920)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     promoter        complement(4921..5025)
                     /note="AmpR promoter"
        1 gtcgacattg attattgact agatcatcgc gtgaggctcc ggtgcccgtc agtgggcaga
       61 gcgcacatcg cccacagtcc ccgagaagtt ggggggaggg gtcggcaatt gaaccggtgc
      121 ctagagaagg tggcgcgggg taaactggga aagtgatgtc gtgtactggc tccgcctttt
      181 tcccgagggt gggggagaac cgtatataag tgcagtagtc gccgtgaacg ttctttttcg
      241 caacgggttt gccgccagaa cacaggtaag tgccgtgtgt ggttcccgcg ggcctggcct
      301 ctttacgggt tatggccctt gcgtgccttg aattacttcc acgcccctgg ctgcagtacg
      361 tgattcttga tcccgagctt cgggttggaa gtgggtggga gagttcgagg ccttgcgctt
      421 aaggagcccc ttcgcctcgt gcttgagttg aggcctggcc tgggcgctgg ggccgccgcg
      481 tgcgaatctg gtggcacctt cgcgcctgtc tcgctgcttt cgataagtct ctagccattt
      541 aaaatttttg atgacctgct gcgacgcttt ttttctggca agatagtctt gtaaatgcgg
      601 gccaagatct gcacactggt atttcggttt ttggggccgc gggcggcgac ggggcccgtg
      661 cgtcccagcg cacatgttcg gcgaggcggg gcctgcgagc gcggccaccg agaatcggac
      721 gggggtagtc tcaagctggc cggcctgctc tggtgcctgg cctcgcgccg ccgtgtatcg
      781 ccccgccctg ggcggcaagg ctggcccggt cggcaccagt tgcgtgagcg gaaagatggc
      841 cgcttcccgg ccctgctgca gggagctcaa aatggaggac gcggcgctcg ggagagcggg
      901 cgggtgagtc acccacacaa aggaaaaggg cctttccgtc ctcagccgtc gcttcatgtg
      961 actccacgga gtaccgggcg ccgtccaggc acctcgatta gttctcgagc ttttggagta
     1021 cgtcgtcttt aggttggggg gaggggtttt atgcgatgga gtttccccac actgagtggg
     1081 tggagactga agttaggcca gcttggcact tgatgtaatt ctccttggaa tttgcccttt
     1141 ttgagtttgg atcttggttc attctcaagc ctcagacagt ggttcaaagt ttttttcttc
     1201 catttcaggt gtcgtgagga attctgcagt cgacggtacc gcgggcccgg gatccaccgg
     1261 tcgccaccat ggtgagcaag ggcgaggagc tgttcaccgg ggtggtgccc atcctggtcg
     1321 agctggacgg cgacgtaaac ggccacaagt tcagcgtgtc cggcgagggc gagggcgatg
     1381 ccacctacgg caagctgacc ctgaagttca tctgcaccac cggcaagctg cccgtgccct
     1441 ggcccaccct cgtgaccacc ctgacctacg gcgtgcagtg cttcagccgc taccccgacc
     1501 acatgaagca gcacgacttc ttcaagtccg ccatgcccga aggctacgtc caggagcgca
     1561 ccatcttctt caaggacgac ggcaactaca agacccgcgc cgaggtgaag ttcgagggcg
     1621 acaccctggt gaaccgcatc gagctgaagg gcatcgactt caaggaggac ggcaacatcc
     1681 tggggcacaa gctggagtac aactacaaca gccacaacgt ctatatcatg gccgacaagc
     1741 agaagaacgg catcaaggtg aacttcaaga tccgccacaa catcgaggac ggcagcgtgc
     1801 agctcgccga ccactaccag cagaacaccc ccatcggcga cggccccgtg ctgctgcccg
     1861 acaaccacta cctgagcacc cagtccgccc tgagcaaaga ccccaacgag aagcgcgatc
     1921 acatggtcct gctggagttc gtgaccgccg ccgggatcac tctcggcatg gacgagctgt
     1981 acaagtaaag cggccgcact cctcaggtgc aggctgccta tcagaaggtg gtggctggtg
     2041 tggccaatgc cctggctcac aaataccact gagatctttt tccctctgcc aaaaattatg
     2101 gggacatcat gaagcccctt gagcatctga cttctggcta ataaaggaaa tttattttca
     2161 ttgcaatagt gtgttggaat tttttgtgtc tctcactcgg aaggacatat gggagggcaa
     2221 atcatttaaa acatcagaat gagtatttgg tttagagttt ggcaacatat gccatatgct
     2281 ggctgccatg aacaaaggtg gctataaaga ggtcatcagt atatgaaaca gccccctgct
     2341 gtccattcct tattccatag aaaagccttg acttgaggtt agattttttt tatattttgt
     2401 tttgtgttat ttttttcttt aacatcccta aaattttcct tacatgtttt actagccaga
     2461 tttttcctcc tctcctgact actcccagtc atagctgtcc ctcttctctt atgaagatcc
     2521 ctcgacctgc agcccaagct tggcgtaatc atggtcatag ctgtttcctg tgtgaaattg
     2581 ttatccgctc acaattccac acaacatacg agccggaagc ataaagtgta aagcctgggg
     2641 tgcctaatga gtgagctaac tcacattaat tgcgttgcgc tcactgcccg ctttccagtc
     2701 gggaaacctg tcgtgccagc ggatccgcat ctcaattagt cagcaaccat agtcccgccc
     2761 ctaactccgc ccatcccgcc cctaactccg cccagttccg cccattctcc gccccatggc
     2821 tgactaattt tttttattta tgcagaggcc gaggccgcct cggcctctga gctattccag
     2881 aagtagtgag gaggcttttt tggaggccta ggcttttgca aaaagctaac ttgtttattg
     2941 cagcttataa tggttacaaa taaagcaata gcatcacaaa tttcacaaat aaagcatttt
     3001 tttcactgca ttctagttgt ggtttgtcca aactcatcaa tgtatcttat catgtctgga
     3061 tccgctgcat taatgaatcg gccaacgcgc ggggagaggc ggtttgcgta ttgggcgctc
     3121 ttccgcttcc tcgctcactg actcgctgcg ctcggtcgtt cggctgcggc gagcggtatc
     3181 agctcactca aaggcggtaa tacggttatc cacagaatca ggggataacg caggaaagaa
     3241 catgtgagca aaaggccagc aaaaggccag gaaccgtaaa aaggccgcgt tgctggcgtt
     3301 tttccatagg ctccgccccc ctgacgagca tcacaaaaat cgacgctcaa gtcagaggtg
     3361 gcgaaacccg acaggactat aaagatacca ggcgtttccc cctggaagct ccctcgtgcg
     3421 ctctcctgtt ccgaccctgc cgcttaccgg atacctgtcc gcctttctcc cttcgggaag
     3481 cgtggcgctt tctcaatgct cacgctgtag gtatctcagt tcggtgtagg tcgttcgctc
     3541 caagctgggc tgtgtgcacg aaccccccgt tcagcccgac cgctgcgcct tatccggtaa
     3601 ctatcgtctt gagtccaacc cggtaagaca cgacttatcg ccactggcag cagccactgg
     3661 taacaggatt agcagagcga ggtatgtagg cggtgctaca gagttcttga agtggtggcc
     3721 taactacggc tacactagaa ggacagtatt tggtatctgc gctctgctga agccagttac
     3781 cttcggaaaa agagttggta gctcttgatc cggcaaacaa accaccgctg gtagcggtgg
     3841 tttttttgtt tgcaagcagc agattacgcg cagaaaaaaa ggatctcaag aagatccttt
     3901 gatcttttct acggggtctg acgctcagtg gaacgaaaac tcacgttaag ggattttggt
     3961 catgagatta tcaaaaagga tcttcaccta gatcctttta aattaaaaat gaagttttaa
     4021 atcaatctaa agtatatatg agtaaacttg gtctgacagt taccaatgct taatcagtga
     4081 ggcacctatc tcagcgatct gtctatttcg ttcatccata gttgcctgac tccccgtcgt
     4141 gtagataact acgatacggg agggcttacc atctggcccc agtgctgcaa tgataccgcg
     4201 agacccacgc tcaccggctc cagatttatc agcaataaac cagccagccg gaagggccga
     4261 gcgcagaagt ggtcctgcaa ctttatccgc ctccatccag tctattaatt gttgccggga
     4321 agctagagta agtagttcgc cagttaatag tttgcgcaac gttgttgcca ttgctacagg
     4381 catcgtggtg tcacgctcgt cgtttggtat ggcttcattc agctccggtt cccaacgatc
     4441 aaggcgagtt acatgatccc ccatgttgtg caaaaaagcg gttagctcct tcggtcctcc
     4501 gatcgttgtc agaagtaagt tggccgcagt gttatcactc atggttatgg cagcactgca
     4561 taattctctt actgtcatgc catccgtaag atgcttttct gtgactggtg agtactcaac
     4621 caagtcattc tgagaatagt gtatgcggcg accgagttgc tcttgcccgg cgtcaatacg
     4681 ggataatacc gcgccacata gcagaacttt aaaagtgctc atcattggaa aacgttcttc
     4741 ggggcgaaaa ctctcaagga tcttaccgct gttgagatcc agttcgatgt aacccactcg
     4801 tgcacccaac tgatcttcag catcttttac tttcaccagc gtttctgggt gagcaaaaac
     4861 aggaaggcaa aatgccgcaa aaaagggaat aagggcgaca cggaaatgtt gaatactcat
     4921 actcttcctt tttcaatatt attgaagcat ttatcagggt tattgtctca tgagcggata
     4981 catatttgaa tgtatttaga aaaataaaca aataggggtt ccgcgcacat ttccccgaaa
     5041 agtgccacct g


Product is for research use only!


Search name

pEF-GFP,Plasmid pEF-GFP,pEF-GFP vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
