pEF- GFP Plasmid


  • Model: PVT1034
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pEF-GFP,Plasmid pEF-GFP,pEF-GFP vector


pEF-GFP Information

Promoter: EF-1 alpha promoter

Replicator: ColE1 ori, SV40 ori

Terminator: SV40 poly (A) signal

Plasmid classification: lactation series plasmids; mammalian expression plasmids; pEF series plasmids

Plasmid size: 5051bp

Plasmid label: C-EGFP

Prokaryotic resistance: ampicillin Amp (100 u g/ml)

Cloned strains of Escherichia coli, DH5 A and other Escherichia coli

Culture conditions: 37 centigrade, aerobic, LB

Expression host: mammalian cells such as 293T

Culture conditions: 37 C, 5%CO2

Induction mode: no induction, instantaneous expression

5'sequencing primers: EF-1 alpha -F (GAATTACTTCCACGCCCCTG)

3'sequencing primers: beta -globin-R (ATGTCCTTCCGAGTGAGAGAC)


pEF-GFP Description

PEF-GFP is a high-level expression plasmid in mammalian cells. EF1 promoter promotes the fusion expression of target gene and green fluorescent protein EGFP. There are EcoRI, KpnI, XmaI and SmaI cleavage sites in MCS region, which can be easily cloned into target genes.



pEF-GFP Sequence

LOCUS       Exported                5051 bp ds-DNA     circular SYN 19-Sept-2016
DEFINITION  synthetic circular DNA
KEYWORDS    Untitled 2
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 5051)
  TITLE     Direct Submission
  JOURNAL   Exported 2016-09-09
FEATURES             Location/Qualifiers
     source          1..5051
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     promoter        36..1217
                     /note="EF-1-alpha promoter"
                     /note="strong constitutive promoter for human elongation
                     factor EF-1-alpha"
     intron          266..1208
                     /note="EF-1-alpha intron A"
                     /note="intron upstream of the start codon of human
     CDS             1269..1988
                     /product="enhanced GFP"
                     /note="mammalian codon-optimized"
     polyA_site      2140..2195
                     /note="beta-globin poly(A) signal"
                     /note="rabbit beta-globin polyadenylation signal"
     primer_bind     complement(2554..2570)
                     /note="M13 rev"
                     /note="common sequencing primer, one of multiple similar
     protein_bind    2578..2594
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(2602..2632)
                     /note="lac promoter"
                     /note="promoter for the E. coli lac operon"
     protein_bind    2647..2668
                     /bound_moiety="E. coli catabolite activator protein"
                     /note="CAP binding site"
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     promoter        2727..2922
                     /note="SV40 promoter"
                     /note="SV40 early promoter"
     rep_origin      2773..2908
                     /note="SV40 ori"
                     /note="SV40 origin of replication"
     polyA_signal    2928..3062
                     /note="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     rep_origin      complement(3301..3889)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     CDS             complement(4060..4920)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     promoter        complement(4921..5025)
                     /note="AmpR promoter"
        1 gtcgacattg attattgact agatcatcgc gtgaggctcc ggtgcccgtc agtgggcaga
       61 gcgcacatcg cccacagtcc ccgagaagtt ggggggaggg gtcggcaatt gaaccggtgc
      121 ctagagaagg tggcgcgggg taaactggga aagtgatgtc gtgtactggc tccgcctttt
      181 tcccgagggt gggggagaac cgtatataag tgcagtagtc gccgtgaacg ttctttttcg
      241 caacgggttt gccgccagaa cacaggtaag tgccgtgtgt ggttcccgcg ggcctggcct
      301 ctttacgggt tatggccctt gcgtgccttg aattacttcc acgcccctgg ctgcagtacg
      361 tgattcttga tcccgagctt cgggttggaa gtgggtggga gagttcgagg ccttgcgctt
      421 aaggagcccc ttcgcctcgt gcttgagttg aggcctggcc tgggcgctgg ggccgccgcg
      481 tgcgaatctg gtggcacctt cgcgcctgtc tcgctgcttt cgataagtct ctagccattt
      541 aaaatttttg atgacctgct gcgacgcttt ttttctggca agatagtctt gtaaatgcgg
      601 gccaagatct gcacactggt atttcggttt ttggggccgc gggcggcgac ggggcccgtg
      661 cgtcccagcg cacatgttcg gcgaggcggg gcctgcgagc gcggccaccg agaatcggac
      721 gggggtagtc tcaagctggc cggcctgctc tggtgcctgg cctcgcgccg ccgtgtatcg
      781 ccccgccctg ggcggcaagg ctggcccggt cggcaccagt tgcgtgagcg gaaagatggc
      841 cgcttcccgg ccctgctgca gggagctcaa aatggaggac gcggcgctcg ggagagcggg
      901 cgggtgagtc acccacacaa aggaaaaggg cctttccgtc ctcagccgtc gcttcatgtg
      961 actccacgga gtaccgggcg ccgtccaggc acctcgatta gttctcgagc ttttggagta
     1021 cgtcgtcttt aggttggggg gaggggtttt atgcgatgga gtttccccac actgagtggg
     1081 tggagactga agttaggcca gcttggcact tgatgtaatt ctccttggaa tttgcccttt
     1141 ttgagtttgg atcttggttc attctcaagc ctcagacagt ggttcaaagt ttttttcttc
     1201 catttcaggt gtcgtgagga attctgcagt cgacggtacc gcgggcccgg gatccaccgg

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
