pEF1- V5- HisA

$215.00

  • Model: PVT10734
  • 50 Units in Stock
Ask a question


Add to Cart:

pEF1-V5-HisA


Catalog No. PVT10734
Packing 2ug
Function Mammal expression plasmid
Resistance Amp
Screen Neo/G418
Strain DH5alpha
Culture temperature 37degrees centigrade
Replicon pUC
Copy high
Promoter EF-1a
Induction T7-F:5'd[TAATACGACTCACTATAGGG]3'
Forward primer
Reverse primer Screening markers: neomycin

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart