pEF1/myc-His A

$280.00

  • Model: PVTY00988
  • 20 Units in Stock
Ask a question


Add to Cart:

pEF1/myc-His A

PVTY00988  2ug

pEF1/myc-His A Description

Alias: pEF1/myc-HisA Plasmid type: Mammalian expression vector Copy number: High copy Promoter: EF-1a Size: 6165 bp 5' Sequencing primers and sequences: T7 Fwd:5'd[TAATACGACTCACTATAGGG]3' Tags: 6X His, myc Resistance(s): Ampicillin (Amp) Selectable markers: Neomycin

Caution:
1.  This product is FOR RESEARCH USE ONLY!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart