
  • Model: PVT1203
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT1203       2ug


pEGFP-N2 Information

Promoter: CMV promoter

Replicator: F1 ori, SV40 ori, pUC ori

Terminator: SV40 poly (A) signal

Plasmid classification: lactation series plasmids; lactating fluorescent plasmids; lactation green plasmids

Plasmid size: 4737bp

Plasmid label: C-EGFP

Prokaryotic resistance: kanamycin Kan (50 mu g/ml)

Screening markers: neomycin Neo/G418

Cloned strains of Escherichia coli, DH5 A and other Escherichia coli

Culture conditions: 37 centigrade, aerobic, LB

Expression host: mammalian cells such as 293T

Culture conditions: 37 centigrade, aerobic, 5%CO2

Induction mode: no induction, instantaneous expression

5'sequencing primers: pEGFP-N-5:TGGGAGGTCTATATAAGCAGAG

3'sequencing primers: pEGFP-N-3: CGTCGCCGTCCAGCTCGACCAG


pEGFP-N2 Description

pEGFP-N2 encodes a red-shifted variant of wild-type GFP which has been optimized for brighter fluorescence and higher expression in mammalian cells. (Excitation maximum = 488 nm; emission maximum = 507 nm.) pEGFP-N1 encodes the GFPmut1 variant which contains the double-amino-acid substitution of Phe-64 to Leu and Ser-65 to Thr. The coding sequence of the EGFP gene contains more than 190 silent base changes which correspond to human codon-usage preferences. Sequences flanking EGFP have been converted to a Kozak consensus translation initiation site to further increase the translation efficiency in eukaryotic cells. The MCS in pEGFP-N1 is between the immediate early promoter of CMV and the EGFP coding sequences. Genes cloned into the MCS will be expressed as fusions to the N-terminus of EGFP if they are in the same reading frame as EGFP and there are no intervening stop codons. SV40 polyadenylation signals downstream of the EGFP gene direct proper processing of the 3' end of the EGFP mRNA. The vector backbone also contains an SV40 origin for replication in mammalian cells expressing the SV40 T antigen. A neomycin-resistance cassette, consisting of the SV40 early promoter, the neomycin/kanamycin resistance gene of Tn5, and polyadenylation signals from the Herpes simplex virus thymidine kinase (HSV TK) gene, allows stably transfected eukaryotic cells to be selected using G418. A bacterial promoter upstream of this cassette expresses kanamycin resistance in E. coli. The pEGFP-N1 backbone also provides a pUC origin of replication for propagation in E. coli and an f1 origin for single-stranded DNA production. Fusions to the N terminus of EGFP retain the fluorescent properties of the native protein allowing the localization of the fusion protein in vivo . The target gene should be cloned into pEGFP-N1 so that it is in frame with the EGFP coding sequences, with no intervening in-frame stop codons. The inserted gene should include the initiating ATG codon. The recombinant EGFP vector can be transfected into mammalian cells using any standard transfection method. If required, stable transformants can be selected using G418 . pEGFP-N1 can also be used simply to express EGFP in a cell line of interest (e.g., as a transfection marker).




pEGFP-N2 Sequence

LOCUS       Exported                4737 bp ds-DNA     circular SYN 30-AUG-2016

DEFINITION  synthetic circular DNA

KEYWORDS    Untitled 8

SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 4737)

  AUTHORS   admin

  TITLE     Direct Submission

  JOURNAL   Exported 2015-10-22 

REFERENCE   2  (bases 1 to 4737)


  TITLE     Direct Submission

  JOURNAL   Exported Tuesday, August 30, 2016 from SnapGene Viewer 3.1.4

FEATURES             Location/Qualifiers

     source          1..4737

                     /organism="synthetic DNA construct"

                     /mol_type="other DNA"

     enhancer        61..364

                     /note="CMV enhancer"

                     /note="CMV enhancer;human cytomegalovirus immediate early 


     promoter        365..568

                     /note="CMV promoter"

                     /note="CMV promoter;human cytomegalovirus (CMV) immediate 

                     early promoter"

     misc_feature    609..665


                     /note="MCS;multiple cloning site"

     CDS             683..1402


                     /product="enhanced GFP"

                     /note="enhanced GFP"

                     /note="EGFP;mammalian codon-optimized"






     polyA_signal    1525..1646

                     /note="SV40 poly(A) signal"

                     /note="SV40 poly(A) signal;SV40 polyadenylation signal"

     rep_origin      complement(1653..2108)


                     /note="f1 ori"

                     /note="f1 ori;f1 bacteriophage origin of replication; arrow

                     indicates direction of (+) strand synthesis"

     promoter        2135..2239


                     /note="bla AmpR promoter"

                     /note="AmpR promoter"

     promoter        2241..2598

                     /note="SV40 promoter"

                     /note="SV40 promoter;SV40 enhancer and early promoter"

     rep_origin      2449..2584

                     /note="SV40 ori"

                     /note="SV40 ori;SV40 origin of replication"

     CDS             2633..3427


                     /gene="aph(3')-II (or nptII)"

                     /product="aminoglycoside phosphotransferase from Tn5"

                     /note="aph(3')-II (or nptII)"

                     /note="NeoR/KanR;confers resistance to neomycin, kanamycin,

                     and G418 (Geneticin(R))"






     polyA_signal    3659..3706

                     /note="HSV TK poly(A) signal"

                     /note="HSV TK poly(A) signal;herpesvirus thymidine kinase 

                     polyadenylation signal"

     rep_origin      4035..4623



                     /note="ori;high-copy-number ColE1/pMB1/pBR322/pUC origin of



        1 tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata tggagttccg

       61 cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt

      121 gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc attgacgtca

      181 atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt atcatatgcc

      241 aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt atgcccagta

      301 catgacctta tgggactttc ctacttggca gtacatctac gtattagtca tcgctattac

      361 catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg actcacgggg

      421 atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc aaaatcaacg

      481 ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg gtaggcgtgt

      541 acggtgggag gtctatataa gcagagctgg tttagtgaac cgtcagatcc gctagcgcta

      601 ccggactcag atctcgagct caagcttcga attctgcagt cgacggtacc gcgggcccgg

      661 gatccaccgg ccggtcgcca ccatggtgag caagggcgag gagctgttca ccggggtggt

      721 gcccatcctg gtcgagctgg acggcgacgt aaacggccac aagttcagcg tgtccggcga

      781 gggcgagggc gatgccacct acggcaagct gaccctgaag ttcatctgca ccaccggcaa

      841 gctgcccgtg ccctggccca ccctcgtgac caccctgacc tacggcgtgc agtgcttcag

      901 ccgctacccc gaccacatga agcagcacga cttcttcaag tccgccatgc ccgaaggcta

      961 cgtccaggag cgcaccatct tcttcaagga cgacggcaac tacaagaccc gcgccgaggt

     1021 gaagttcgag ggcgacaccc tggtgaaccg catcgagctg aagggcatcg acttcaagga

     1081 ggacggcaac atcctggggc acaagctgga gtacaactac aacagccaca acgtctatat

     1141 catggccgac aagcagaaga acggcatcaa ggtgaacttc aagatccgcc acaacatcga

     1201 ggacggcagc gtgcagctcg ccgaccacta ccagcagaac acccccatcg gcgacggccc

     1261 cgtgctgctg cccgacaacc actacctgag cacccagtcc gccctgagca aagaccccaa

     1321 cgagaagcgc gatcacatgg tcctgctgga gttcgtgacc gccgccggga tcactctcgg

     1381 catggacgag ctgtacaagt aaagcggccg cgactctaga tcataatcag ccataccaca

     1441 tttgtagagg ttttacttgc tttaaaaaac ctcccacacc tccccctgaa cctgaaacat

     1501 aaaatgaatg caattgttgt tgttaacttg tttattgcag cttataatgg ttacaaataa

     1561 agcaatagca tcacaaattt cacaaataaa gcattttttt cactgcattc tagttgtggt

     1621 ttgtccaaac tcatcaatgt atcttaaggc gtaaattgta agcgttaata ttttgttaaa

     1681 attcgcgtta aatttttgtt aaatcagctc attttttaac caataggccg aaatcggcaa

     1741 aatcccttat aaatcaaaag aatagaccga gatagggttg agtgttgttc cagtttggaa

     1801 caagagtcca ctattaaaga acgtggactc caacgtcaaa gggcgaaaaa ccgtctatca

     1861 gggcgatggc ccactacgtg aaccatcacc ctaatcaagt tttttggggt cgaggtgccg

     1921 taaagcacta aatcggaacc ctaaagggag cccccgattt agagcttgac ggggaaagcc

     1981 ggcgaacgtg gcgagaaagg aagggaagaa agcgaaagga gcgggcgcta gggcgctggc

     2041 aagtgtagcg gtcacgctgc gcgtaaccac cacacccgcc gcgcttaatg cgccgctaca

     2101 gggcgcgtca ggtggcactt ttcggggaaa tgtgcgcgga acccctattt gtttattttt

     2161 ctaaatacat tcaaatatgt atccgctcat gagacaataa ccctgataaa tgcttcaata

     2221 atattgaaaa aggaagagtc ctgaggcgga aagaaccagc tgtggaatgt gtgtcagtta

     2281 gggtgtggaa agtccccagg ctccccagca ggcagaagta tgcaaagcat gcatctcaat

     2341 tagtcagcaa ccaggtgtgg aaagtcccca ggctccccag caggcagaag tatgcaaagc

     2401 atgcatctca attagtcagc aaccatagtc ccgcccctaa ctccgcccat cccgccccta

     2461 actccgccca gttccgccca ttctccgccc catggctgac taattttttt tatttatgca

     2521 gaggccgagg ccgcctcggc ctctgagcta ttccagaagt agtgaggagg cttttttgga

     2581 ggcctaggct tttgcaaaga tcgatcaaga gacaggatga ggatcgtttc gcatgattga

     2641 acaagatgga ttgcacgcag gttctccggc cgcttgggtg gagaggctat tcggctatga

     2701 ctgggcacaa cagacaatcg gctgctctga tgccgccgtg ttccggctgt cagcgcaggg

     2761 gcgcccggtt ctttttgtca agaccgacct gtccggtgcc ctgaatgaac tgcaagacga

     2821 ggcagcgcgg ctatcgtggc tggccacgac gggcgttcct tgcgcagctg tgctcgacgt

     2881 tgtcactgaa gcgggaaggg actggctgct attgggcgaa gtgccggggc aggatctcct

     2941 gtcatctcac cttgctcctg ccgagaaagt atccatcatg gctgatgcaa tgcggcggct

     3001 gcatacgctt gatccggcta cctgcccatt cgaccaccaa gcgaaacatc gcatcgagcg

     3061 agcacgtact cggatggaag ccggtcttgt cgatcaggat gatctggacg aagagcatca

     3121 ggggctcgcg ccagccgaac tgttcgccag gctcaaggcg agcatgcccg acggcgagga

     3181 tctcgtcgtg acccatggcg atgcctgctt gccgaatatc atggtggaaa atggccgctt

     3241 ttctggattc atcgactgtg gccggctggg tgtggcggac cgctatcagg acatagcgtt

     3301 ggctacccgt gatattgctg aagagcttgg cggcgaatgg gctgaccgct tcctcgtgct

     3361 ttacggtatc gccgctcccg attcgcagcg catcgccttc tatcgccttc ttgacgagtt

     3421 cttctgagcg ggactctggg gttcgaaatg accgaccaag cgacgcccaa cctgccatca

     3481 cgagatttcg attccaccgc cgccttctat gaaaggttgg gcttcggaat cgttttccgg

     3541 gacgccggct ggatgatcct ccagcgcggg gatctcatgc tggagttctt cgcccaccct

     3601 agggggaggc taactgaaac acggaaggag acaataccgg aaggaacccg cgctatgacg

     3661 gcaataaaaa gacagaataa aacgcacggt gttgggtcgt ttgttcataa acgcggggtt

     3721 cggtcccagg gctggcactc tgtcgatacc ccaccgagac cccattgggg ccaatacgcc

     3781 cgcgtttctt ccttttcccc accccacccc ccaagttcgg gtgaaggccc agggctcgca

     3841 gccaacgtcg gggcggcagg ccctgccata gcctcaggtt actcatatat actttagatt

     3901 gatttaaaac ttcattttta atttaaaagg atctaggtga agatcctttt tgataatctc

     3961 atgaccaaaa tcccttaacg tgagttttcg ttccactgag cgtcagaccc cgtagaaaag

     4021 atcaaaggat cttcttgaga tccttttttt ctgcgcgtaa tctgctgctt gcaaacaaaa

     4081 aaaccaccgc taccagcggt ggtttgtttg ccggatcaag agctaccaac tctttttccg

     4141 aaggtaactg gcttcagcag agcgcagata ccaaatactg tccttctagt gtagccgtag

     4201 ttaggccacc acttcaagaa ctctgtagca ccgcctacat acctcgctct gctaatcctg

     4261 ttaccagtgg ctgctgccag tggcgataag tcgtgtctta ccgggttgga ctcaagacga

     4321 tagttaccgg ataaggcgca gcggtcgggc tgaacggggg gttcgtgcac acagcccagc

     4381 ttggagcgaa cgacctacac cgaactgaga tacctacagc gtgagctatg agaaagcgcc

     4441 acgcttcccg aagggagaaa ggcggacagg tatccggtaa gcggcagggt cggaacagga

     4501 gagcgcacga gggagcttcc agggggaaac gcctggtatc tttatagtcc tgtcgggttt

     4561 cgccacctct gacttgagcg tcgatttttg tgatgctcgt caggggggcg gagcctatgg

     4621 aaaaacgcca gcaacgcggc ctttttacgg ttcctggcct tttgctggcc ttttgctcac

     4681 atgttctttc ctgcgttatc ccctgattct gtggataacc gtattaccgc catgcat



Product is for research use only!


Search name

pEGFP-N2,Plasmid pEGFP-N2,pEGFP-N2 vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
