pEGFP- N2 Plasmid


  • Model: PVT1203
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pEGFP-N2,Plasmid pEGFP-N2,pEGFP-N2 vector


pEGFP-N2 Information

Promoter: CMV promoter

Replicator: F1 ori, SV40 ori, pUC ori

Terminator: SV40 poly (A) signal

Plasmid classification: lactation series plasmids; lactating fluorescent plasmids; lactation green plasmids

Plasmid size: 4737bp

Plasmid label: C-EGFP

Prokaryotic resistance: kanamycin Kan (50 mu g/ml)

Screening markers: neomycin Neo/G418

Cloned strains of Escherichia coli, DH5 A and other Escherichia coli

Culture conditions: 37 centigrade, aerobic, LB

Expression host: mammalian cells such as 293T

Culture conditions: 37 centigrade, aerobic, 5%CO2

Induction mode: no induction, instantaneous expression

5'sequencing primers: pEGFP-N-5:TGGGAGGTCTATATAAGCAGAG

3'sequencing primers: pEGFP-N-3: CGTCGCCGTCCAGCTCGACCAG


pEGFP-N2 Description

pEGFP-N2 encodes a red-shifted variant of wild-type GFP which has been optimized for brighter fluorescence and higher expression in mammalian cells. (Excitation maximum = 488 nm; emission maximum = 507 nm.) pEGFP-N1 encodes the GFPmut1 variant which contains the double-amino-acid substitution of Phe-64 to Leu and Ser-65 to Thr. The coding sequence of the EGFP gene contains more than 190 silent base changes which correspond to human codon-usage preferences. Sequences flanking EGFP have been converted to a Kozak consensus translation initiation site to further increase the translation efficiency in eukaryotic cells. The MCS in pEGFP-N1 is between the immediate early promoter of CMV and the EGFP coding sequences. Genes cloned into the MCS will be expressed as fusions to the N-terminus of EGFP if they are in the same reading frame as EGFP and there are no intervening stop codons. SV40 polyadenylation signals downstream of the EGFP gene direct proper processing of the 3' end of the EGFP mRNA. The vector backbone also contains an SV40 origin for replication in mammalian cells expressing the SV40 T antigen. A neomycin-resistance cassette, consisting of the SV40 early promoter, the neomycin/kanamycin resistance gene of Tn5, and polyadenylation signals from the Herpes simplex virus thymidine kinase (HSV TK) gene, allows stably transfected eukaryotic cells to be selected using G418. A bacterial promoter upstream of this cassette expresses kanamycin resistance in E. coli. The pEGFP-N1 backbone also provides a pUC origin of replication for propagation in E. coli and an f1 origin for single-stranded DNA production. Fusions to the N terminus of EGFP retain the fluorescent properties of the native protein allowing the localization of the fusion protein in vivo . The target gene should be cloned into pEGFP-N1 so that it is in frame with the EGFP coding sequences, with no intervening in-frame stop codons. The inserted gene should include the initiating ATG codon. The recombinant EGFP vector can be transfected into mammalian cells using any standard transfection method. If required, stable transformants can be selected using G418 . pEGFP-N1 can also be used simply to express EGFP in a cell line of interest (e.g., as a transfection marker).



pEGFP-N2 Sequence

LOCUS       Exported                4737 bp ds-DNA     circular SYN 30-AUG-2016
DEFINITION  synthetic circular DNA
KEYWORDS    Untitled 8
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4737)
  AUTHORS   admin
  TITLE     Direct Submission
  JOURNAL   Exported 2015-10-22   
REFERENCE   2  (bases 1 to 4737)
  TITLE     Direct Submission
  JOURNAL   Exported Tuesday, August 30, 2016 from SnapGene Viewer 3.1.4
FEATURES             Location/Qualifiers
     source          1..4737
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     enhancer        61..364
                     /note="CMV enhancer"
                     /note="CMV enhancer;human cytomegalovirus immediate early 
     promoter        365..568
                     /note="CMV promoter"
                     /note="CMV promoter;human cytomegalovirus (CMV) immediate 
                     early promoter"
     misc_feature    609..665
                     /note="MCS;multiple cloning site"
     CDS             683..1402
                     /product="enhanced GFP"
                     /note="enhanced GFP"
                     /note="EGFP;mammalian codon-optimized"
     polyA_signal    1525..1646
                     /note="SV40 poly(A) signal"
                     /note="SV40 poly(A) signal;SV40 polyadenylation signal"
     rep_origin      complement(1653..2108)
                     /note="f1 ori"
                     /note="f1 ori;f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     promoter        2135..2239
                     /note="bla AmpR promoter"
                     /note="AmpR promoter"
     promoter        2241..2598
                     /note="SV40 promoter"
                     /note="SV40 promoter;SV40 enhancer and early promoter"
     rep_origin      2449..2584
                     /note="SV40 ori"
                     /note="SV40 ori;SV40 origin of replication"
     CDS             2633..3427
                     /gene="aph(3')-II (or nptII)"
                     /product="aminoglycoside phosphotransferase from Tn5"
                     /note="aph(3')-II (or nptII)"
                     /note="NeoR/KanR;confers resistance to neomycin, kanamycin,
                     and G418 (Geneticin(R))"
     polyA_signal    3659..3706
                     /note="HSV TK poly(A) signal"
                     /note="HSV TK poly(A) signal;herpesvirus thymidine kinase 
                     polyadenylation signal"
     rep_origin      4035..4623
                     /note="ori;high-copy-number ColE1/pMB1/pBR322/pUC origin of
        1 tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata tggagttccg
       61 cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt
      121 gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc attgacgtca
      181 atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt atcatatgcc
      241 aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt atgcccagta
      301 catgacctta tgggactttc ctacttggca gtacatctac gtattagtca tcgctattac
      361 catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg actcacgggg
      421 atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc aaaatcaacg
      481 ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg gtaggcgtgt
      541 acggtgggag gtctatataa gcagagctgg tttagtgaac cgtcagatcc gctagcgcta
      601 ccggactcag atctcgagct caagcttcga attctgcagt cgacggtacc gcgggcccgg
      661 gatccaccgg ccggtcgcca ccatggtgag caagggcgag gagctgttca ccggggtggt
      721 gcccatcctg gtcgagctgg acggcgacgt aaacggccac aagttcagcg tgtccggcga
      781 gggcgagggc gatgccacct acggcaagct gaccctgaag ttcatctgca ccaccggcaa
      841 gctgcccgtg ccctggccca ccctcgtgac caccctgacc tacggcgtgc agtgcttcag
      901 ccgctacccc gaccacatga agcagcacga cttcttcaag tccgccatgc ccgaaggcta
      961 cgtccaggag cgcaccatct tcttcaagga cgacggcaac tacaagaccc gcgccgaggt
     1021 gaagttcgag ggcgacaccc tggtgaaccg catcgagctg aagggcatcg acttcaagga
     1081 ggacggcaac atcctggggc acaagctgga gtacaactac aacagccaca acgtctatat
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
