pEGFP-C1-PRKAA1

$280.00

  • Model: PVT40105
  • 20 Units in Stock
Ask a question


Add to Cart:

pEGFP-C1-PRKAA1

PVT40105       2ug

 

pEGFP-C1-PRKAA1 Description
Species: Rat 
Bacterial Resistance(s): Kan
Growth Temperature: 37°C
Growth Strain : DH5alpha
Copy number:High
Vector type: Mammalian Expression 
Selectable markers: Neo (select with G418)
Size: 6364bp

 

pEGFP-C1-PRKAA1 Sequence (Partial)

GCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAA
CCGTATTACCGCCATGCATTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGC
GTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGT
TCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTAC
ATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTAC
ATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCA
GTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGT
TTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTA
CGGTGGGAGGTCTATATAAGCAGAGCTGGTTTAGTGAACCGTCAGATCCGCTAGCGCTACCGGTCGCCACCATGGTGAGC
AAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGT
GTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTCC
CCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGAC
TTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCG
CGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACA
TCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAG
GTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGG
CGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCG
ATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAGGACGAGCTGTACA
GACATGGCCGAGAAGCAGAAGCACGACGGGCGGGTGAAGATCGGCCACTACATCCTGGGGGACACGCTGGGCGTCGGCAC
CTTCGGGAAAGTGAAGGTGGGCAAGCACGAGTTGACTGGACATAAAGTTGCTGTGAAGATACTCAACCGGCAGAAGATTC
GAAGCCTGGACGTGGTCGGGAAAATCCGCAGAGAGATCCAGAACCTGAAGCTTTTCAGGCACCCTCATATAATCAAACTG
TACCAGGTCATCAGTACACCGTCTGATATTTTCATGGTCATGGAATATGTCTCAGGAGGAGAGCTATTTGATTATATCTG
TAAAAATGGAAGGTTGGACGAAAAGGAGAGTCGACGTCTGTTCCAGCAGATCCTTTCTGGTGTGGACTATTGTCACAGGC
ATATGGTGGTCCACAGAGATTTGAAACCTGAAAACGTCCTGCTTGATGCACACATGAATGCAAAGATAGCCGACTTCGGT
CTTTCAAACATGATGTCAGATGGTGAATTTTTAAGAACGAGCTGTGGCTCGCCCAATTATGCTGCACCAGAAGTAATTTC
AGGAAGATTGTACGCAGGCCCTGAAGTAGACATCTGGAGCAGCGGGGTCATTCTCTATGCTTTGCTGTGTGGAACTCTCC
CTTTTGATGATGACCACGTGCCAACTCTTTTTAAGAAGATATGTGACGGGATATTTTATACCCCTCAGTATTTGAATCCC
TCTGTAATAAGCCTTTTGAAGCATATGCTGCAGGTAGATCCTATGAAGAGGGCCACAATAAAAGATATCAGGGAACATGA
ATGGTTTAAGCAGGACCTTCCAAAATATCTCTTTCCTGAAGACCCGTCTTATAGTTCAACCATGATTGATGATGAAGCCT
TAAAAGAAGTGTGTGAGAAGTTCGAGTGCTCAGAGGAGGAGGTCCTCAGCTGCCTGTACAACAGAAACCACCAGGACCCA
CTGGCAGTTGCCTACCACCTCATAATAGACAACAGGAGAATAATGAACGAAGCCAAAGATTTCTACTTGGCAACAAGCCC
ACCCGATTCTTTCCTCGATGATCACCATTTAACTCGGCCTCACCCTGAGAGAGTACCATTCTTGGTTGCCGAAACACCAA
GGGCCCGACACACCCTAGATGAATTAAACCCACAGAAATCCAAACACCAAGGCGTACGGAAGGCAAAGTGGCATTTGGGG
ATTCGAAGTCAAAGCCGACCCAATGACATCATGGCAGAAGTGTGTAGAGCAATCAAGCAGTTGGACTATGAATGGAAGGT
TGTAAACCCCTATTATTTGCGTGTGCGAAGGAAGAACCCTGTGACAAGCACATTTTCCAAAATGAGTCTACAGCTATACC
AAGTGGATAGTAGGACTTACTTATTGGATTTCCGAAGTATTGATGATGAGATTACAGAAGCCAAATCAGGGACTGCTACT
CCACAGAGATCGGGATCCATCAGCAACTATCGATCTTGCCAAAGGAGCGACTCCGACGCCGAGGCTCAAGGAAAGCCCTC
AGAAGTCTCTCTTACCTCATCCGTGACCTCCCTCGACTCCTCTCCTGTTGACGTAGCTCCAAGACCAGGAAGTCACACGA
TAGAATTTTTTGAAATGTGTGCAAATCTAATTAAAATTCTTGCACAGTAAGAATTCTGCAGTCGACGGTACCGCGGGCCC
GGGATCCACCGGATCTAGATAACTGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCC
CACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTAC
AAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCAT
CAATGTATCTTAACGCGTAAATTGTAAGCGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTT
TTTAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGACCGAGATAGGGTTGAGTGTTGTTCCAGT
TTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCAC
TACGTGAACCATCACCCTAATCAAGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCC
CGATTTAGAGCTTGACGGGGAAAGCCGGCGAACGTGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGC
GCTGGCAAGTGTAGCGGTCACGCTGCGCGTAACCACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGCGCGTCAGGTG
GCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGA
CAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTCCTGAGGCGGAAAGAACCAGCTGTGGAATGTGTGT
CAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAG
GTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGC
CCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATT
TATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTG
CAAAGATCGATCAAGAGACAGGATGAGGATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCT
TGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGC
GCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAAGACGAGGCAGCGCGGCTAT
CGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTG
GGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCG
GCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGA
TGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTC
AAGGCGAGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGG
CCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATA
TTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATC
GCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGAAATGACCGACCAAGCGACGCCCAACCTG
CCATCACGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGGTTGGGCTTCGGAATCGTTTTCCGGGACGCCGGCTGGAT
GATCCTCCAGCGCGGGGATCTCATGCTGGAGTTCTTCGCCCACCCTAGGGGGAGGCTAACTGAAACACGGAAGGAGACAA
TACCGGAAGGAACCCGCGCTATGACGGCAATAAAAAGACAGAATAAAACGCACGGTGTTGGGTCGTTTGTTCATAAACGC
GGGGTTCGGTCCCAGGGCTGGCACTCTGTCGATACCCCACCGAGACCCCATTGGGGCCAATACGCCCGCGTTTCTTCCTT
TTCCCCACCCCACCCCCCAAGTTCGGGTGAAGGCCCAGGGCTCGCAGCCAACGTCGGGGCGGCAGGCCCTGCCATAGCCT
CAGGTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGAT
AATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTC
TTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGG
ATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAG
CCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGC
TGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAA
CGG......
//

 

Caution:
1.  This product is FOR RESEARCH USE ONLY!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart