pENTR223- GNA11

$160.00

  • Model: PVT10058
  • 50 Units in Stock
Ask a question


Add to Cart:

pENTR223-GNA11


Catalog No. PVT10058
Packing 2ug
Function DNA Cloning plasmid
Resistance Spe
Screen /
Strain DH5alpha
Culture temperature 37degrees centigrade
 

pENTR223-GNA11 Sequence

cgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatacgcgtaccgctagccaggaagagtttgtag
aaacgcaaaaaggccatccgtcaggatggccttctgcttagtttgatgcctggcagtttatggcgggcgtcctgcccgcc
accctccgggccgttgcttcacaacgttcaaatccgctcccggcggatttgtcctactcaggagagcgttcaccgacaaa
caacagataaaacgaaaggcccagtcttccgactgagcctttcgttttatttgatgcctggcagttccctactctcgcgt
taacgctagcatggatgttttcccagtcacgacgttgtaaaacgacggccagtcttaagctcgggccccaaataatgatt
ttattttgactgatagtgacctgttcgttgcaacaaattgataagcaatgcttttttataatgccaactttgtacaaaaa
agttggcATGGATCGCCTGTGCTGCCTTCGCCCGCCGCCACACCGGGACCCTGCACGGCTGCTTCTGGCCTCGACAGATG
ACAAAAGAAACAGCCCCAAAATACGACCACTCCAACCAGCAGTTCCCGCCTGCCTGCCCGCCACTGTCAGGCCTGCCCTG
GCCTCCTCGTCCGCAGGGCTGTCTGCTGGCTTCTGGGGGCAGAAGAGCGGGGAGCCCCGTGGAAGGGTCAGGGGAGACCA
GGTCAGGGCAGCTACATTTCTGGTGATCAGCCCCATGGGGAGACGGGGCTGGCGGGATACCGCCCCCCCGGCTTCCCCAC
ACCACTTCTGTCTCACCCGGAAGCGTCCTTTTTTTGTGCCAGGTGTCTACCTAAGAGGGTTGGTGCCAGAAGCCCCCCAT
GGCGAGTGCTGGGGCCCGGCGGTGCCCTGGGGGAGCAGATGGGGCCACCCCTGGCAGGGCCGCTACAACTTTTTCCAGCA
GCGGAGCCCTCTGGGGGGCCTGTGCTTGTGGCATCTCTGCCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATT
GCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTAT
AGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGgcagctctggcccgtgtctcaaaatctctgatgttacattgcaca
agataaaaatatatcatcatgcctcctctagaccagccaggacagaaatgcctcgacttcgctgctgcccaaggttgccg
ggtgacgcacaccgtggaaacggatgaaggcacgaacccagtggacataagcctgttcggttcgtaagctgtaatgcaag
tagcgtatgcgctcacgcaactggtccagaaccttgaccgaacgcagcggtggtaacggcgcagtggcggttttcatggc
ttgttatgactgtttttttggggtacagtctatgcctcgggcatccaagcagcaagcgcgttacgccgtgggtcgatgtt
tgatgttatggagcagcaacgatgttacgcagcagggcagtcgccctaaaacaaagttaaacatcatgagggaagcggtg
atcgccgaagtatcgactcaactatcagaggtagttggcgtcatcgagcgccatctcgaaccgacgttgctggccgtaca
tttgtacggctccgcagtggatggcggcctgaagccacacagtgatattgatttgctggttacggtgaccgtaaggcttg
atgaaacaacgcggcgagctttgatcaacgaccttttggaaacttcggcttcccctggagagagcgagattctccgcgct
gtagaagtcaccattgttgtgcacgacgacatcattccgtggcgttatccagctaagcgcgaactgcaatttggagaatg
gcagcgcaatgacattcttgcaggtatcttcgagccagccacgatcgacattgatctggctatcttgctgacaaaagcaa
gagaacatagcgttgccttggtaggtccagcggcggaggaactctttgatccggttcctgaacaggatctatttgaggcg
ctaaatgaaaccttaacgctatggaactcgccgcccgactgggctggcgatgagcgaaatgtagtgcttacgttgtcccg
catttggtacagcgcagtaaccggcaaaatcgcgccgaaggatgtcgctgccgactgggcaatggagcgcctgccggccc
agtatcagcccgtcatacttgaagctagacaggcttatcttggacaagaagaagatcgcttggcctcgcgcgcagatcag
ttggaagaatttgtccactacgtgaaaggcgagatcaccaaggtagtcggcaaataaccctcgagccacccatgaccaaa
atcccttaacgtgagttacgcgtcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctt
tttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagcta
ccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttagg
ccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcg
ataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcg
tgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagcattgagaaagcgccacgct
tcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggg
gaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggg
gggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgtt
ctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaa
cgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccg
attcattaatgcagctggca
//


Caution:
Product is for research use only!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart