pENTR223- PRG2

$182.00

  • Model: PVT11439
  • 50 Units in Stock
Ask a question


Add to Cart:

pENTR223-PRG2

Catalog No.PVT11439
Packing 2ug


pENTR223-PRG2 Alternative name
pENTR223-PRG2pENTR223-PRG2 vector, pENTR223-PRG2 plasmid, pENTR223-PRG2 map, pENTR223-PRG2 sequence,

 

pENTR223-PRG2 Informaiton

Promoter -
Replicon pBR322
Terminator -
Resistance Spe
Strain DH5alpha
Culture conditions LB,37degrees centigrade
Forward primer M13F
Reverse primer M13R

 

pENTR223-PRG2 Sequence

Homo sapiens proteoglycan 2, bone marrow (natural killer cell activator, eosinophil granule major basic protein), mRNA (cDNA clone MGC:14537 IMAGE:4043815), complete cds

GenBank: BC005929.1


/gene="PRG2"
                     /gene_synonym="BMPG"
                     /gene_synonym="MBP"
                     /gene_synonym="MGC14537"

atgaaactccccctacttctggctcttctatttggggcagtttctgctcttcatctaaggtctgagacttccacctttgagacccctttgggtgctaagacgctgcctgaggatgaggagacaccagagcaggagatggaggagaccccttgcagggagctggaggaagaggaggagtggggctctggaagtgaagatgcctccaagaaagatggggctgttgagtctatctcagtgccagatatggtggacaaaaaccttacgtgtcctgaggaagaggacacagtaaaagtggtgggcatccctgggtgccagacctgccgctacctcctggtgagaagtcttcagacgtttagtcaagcttggtttacttgccggaggtgctacaggggcaacctggtttccatccacaacttcaatattaattatcgaatccagtgttctgtcagcgcgctcaaccagggtcaagtctggattggaggcaggatcacaggctcgggtcgctgcagacgctttcagtgggttgacggcagccgctggaactttgcgtactgggctgctcaccagccctggtcccgcggtggtcactgcgtggccctgtgtacccgaggaggctactggcgtcgagcccactgcctcagaagacttcctttcatctgttcctactga

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart