pENTR223- TMEM87A

$182.00

  • Model: PVT10077
  • 50 Units in Stock
Ask a question


Add to Cart:

pENTR223-TMEM87A


Catalog No. PVT10077
Packing 2ug

 

pENTR223-TMEM87A Information
Function DNA Cloning plasmid
Resistance Spe
Screen /
Strain DH5alpha
Culture temperature 37degrees centigrade

 

pENTR223-TMEM87A Sequence

Homo sapiens transmembrane protein 87A (TMEM87A), transcript variant 2, mRNA

NCBI Reference Sequence: NM_001110503.2

atggcggcggctgcgtggcttcaggtgttgcctgtcattcttctgcttctgggagctcacccgtcaccactgtcgtttttcagtgcgggaccggcaaccgtagctgctgccgaccggtccaaatggcacattccgataccgtcggggaaaaattattttagttttggaaagatcctcttcagaaataccactatcttcctgaagtttgatggagaaccttgtgacctgtctttgaatataacctggtatctgaaaagcgctgattgttacaatgaaatctataacttcaaggcagaagaagtagagttgtatttggaaaaacttaaggaaaaaagaggcttgtctgggaaatatcaaacatcatcaaaattgttccagaactgcagtgaactctttaaaacacagaccttttctggagattttatgcatcgactgcctcttttaggagaaaaacaggaggctaaggagaatggaacaaaccttacctttattggagacaaaaccattcagatgcctttcttgaagaaacatttcttggattgttga

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart