pENTR3C

$215.00

  • Model: PVT11162
  • 50 Units in Stock
Ask a question


Add to Cart:

pENTR3C


Catalog No. PVT11162
Packing 2ug
Function plant expression plasmid
Resistance Kan
Screen /
Strain DB3.1
Culture temperature 37degrees centigrade
Replicon
Copy
Promoter
Induction
Forward primer pENTR-F:CTACAAACTCTTCCTGTTAGTTAG
Reverse primer pENTR-R:ATGGCTCATAACACCCCTTG

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart