pESC- Leu Plasmid


  • Model: PVT4028
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pESC-Leu,Plasmid pESC-Leu,pESC-Leu vector


pESC-LEU Information

Promoter: GAL1, GAL10 promoter

Replicator: 2 ori, ori, FI ori

Terminator: CYC1

Plasmid size: 7758bp

Plasmid label: C-Flag, C-Myc

Prokaryotic resistance: Amp

Screening markers: LEU2

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic, LB

Expression host: yeast cells

5'sequencing primers: GAL1-F: ATTTTCGGTTTGTATTACTTC


Use: Yeast expression


pESC-LEU Desciption

pESC vectors are a series of epitope-tagging vectors for expression of eukaryotic genes in the yeast S. cerevisiae.  Each vector contains GAL1 and GAL10 yeast promoters in opposing orientations. With these vectors you can introduce one or two cloned genes into a yeast host strain under the control of an inducible promoter.  These vectors also feature an extensive polylinker sequence and the ability to generate end-specific RNA transcripts from T3 and T7 promoters.  Each of the pESC vectors contains one of four different yeast-selectable markers (HIS3, TRP1, LEU2, or URA3) in the same vector backbone.
           The pESC vectors contain DNA sequences coding for epitope peptides that can be specifically recognized by monoclonal antibodies.   A sequence for the FLAG® epitope (DYKDDDDK) is located in the multiple cloning site (MCS) downstream of the GAL10 promoter; a sequence for the c-Myc epitope (EQKLISEEDL) is located in the MCS downstream of the GAL1 promoter. You can insert your gene of interest in front of the epitope sequence to generate C-terminal tagging or after the epitope sequence for N-terminal tagging. These tags allow the protein of interest to be studied without generating a specific antibody to that protein. The epitope-tagged fusion proteins can be studied in transformed cells using well-characterized antibodies.
           • Express two different genes simultaneously in S. cerevisiae 
           • Proteins tagged with unique epitope tags 
           • Fast and easy immunoprecipitations

pESC-LEU Sequence

LOCUS       Exported                7758 bp ds-DNA     circular SYN 11-SEP-2016
DEFINITION  synthetic circular DNA
KEYWORDS    Untitled 3
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 7758)
  TITLE     Direct Submission
  JOURNAL   Exported Sunday, September 11, 2016 from SnapGene Viewer 3.1.4
FEATURES             Location/Qualifiers
     source          1..7758
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     CDS             complement(663..1757)
                     /gene="S. cerevisiae LEU2"
                     /product="3-isopropylmalate dehydrogenase, required for 
                     leucine biosynthesis"
                     /note="yeast auxotrophic marker"
     promoter        complement(1770..2174)
                     /gene="S. cerevisiae LEU2"
                     /note="LEU2 promoter"
     rep_origin      complement(2474..2929)
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow 
                     indicates direction of (+) strand synthesis"
     CDS             complement(3325..3348)
                     /product="FLAG(R) epitope tag, followed by an enterokinase 
                     cleavage site"
     promoter        3395..4059
                     /gene="GAL1 and GAL10 genes of S. cerevisiae"
                     /note="GAL1,10 promoter"
                     /note="divergent inducible promoter, regulated by Gal4"
     protein_bind    3611..3728
                     /note="upstream activating sequence mediating 
                     Gal4-dependent induction"
     promoter        4070..4088
                     /note="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     CDS             4106..4135
                     /product="Myc (human c-Myc oncogene) epitope tag"
     terminator      4165..4354
                     /gene="S. cerevisiae CYC1"
                     /note="CYC1 terminator"
                     /note="transcription terminator for CYC1"
     rep_origin      complement(4597..5185)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
     CDS             complement(5356..6216)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     promoter        complement(6217..6321)
                     /note="AmpR promoter"
     rep_origin      6348..7690
                     /note="2u ori"
                     /note="yeast 2u plasmid origin of replication"
     protein_bind    complement(7311..7358)
                     /bound_moiety="FLP recombinase from the Saccharomyces 
                     cerevisiae 2u plasmid"
                     /note="FLP-mediated recombination occurs in the 8-bp core 
                     sequence TCTAGAAA (Turan and Bode, 2011)."
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
