pESC-URA

$280.00

  • Model: PVTY00614
  • 20 Units in Stock
Ask a question


Add to Cart:

pESC-URA

PVTY00614  2ug

pESC-URA Description

Plasmid type: Yeast expression vector Copy number: High copy Induction method: Galactose Promoter: GAL1 and GAL10 Cloning Method: Multiple cloning sites,restriction endonuclease Size: 6631 bp 5' Sequencing primers and sequences: GAL1-F: ATTTTCGGTTTGTATTACTTC; GAL10-F: GGTGGTAATGCCATGTAATATG 3' Sequencing primers and sequences: GALI-R: GTTCTTAATACTAACATAACT GAL10-R: GGCAAGGTAGACAAGCCGACAAC Tags: C-Flag, C-Myc Resistance(s): Ampicillin (Amp) Selectable markers: URA3

Caution:
1.  This product is FOR RESEARCH USE ONLY!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart