pET- 12a


  • Model: PVT0050
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT0050      2ug


pET-12a Information

Promoter: T7/lac
Replicon: ColE1 ori
Terminator: T7 Terminator
Plasmid classification: Escherichia coli vector; PET series expression plasmid
Plasmid size: 4674bp
Plasmid label: N-ompT
Prokaryotic resistance: ampicillin Amp
Cloned strain: DH5 alpha
Culture conditions: 37 centigrade, aerobic, LB
Expression host: BL21 (DE3)
Culture conditions: 37 centigrade, aerobic, LB
Inducement: IPTG or lactose and its analogues
5'sequencing primers: T7:TAATACGACTCACTATAGGG
3'sequencing primers: T7-ter:TGCTAGTTATTGCTCAGCGG
Use:pET Plasmid


pET-12a Description

pET-12a-c vectors carry an N-terminal ompT sequence for potential periplasmic export of target proteins. Unique sites are shown on the circle map. Note that the sequence is numbered by the pBR322 convention, so the T7 expression region is reversed on the circular map. The cloning/ expression region of the coding strand transcribed by T7 RNA polymerase is shown below.



pET-12a  Sequence

LOCUS       pET12a    4674 bp     DNA  circular  SYN
  ORGANISM  other sequences; artificial sequences; vectors.
COMMENT     This file is created by Vector NTI
FEATURES             Location/Qualifiers
     source          1..4674
                     /mol_type="other DNA"
     gene            86..1587
                     /label="tet (w/ gaps)"
                     /gene="tet (w/ gaps)"
     terminator      complement(379..507)
     misc_feature    447..465
     misc_feature    complement(590..606)
     promoter        complement(643..661)
     misc_feature    complement(745..764)
     CDS             798..1385
                     /label="ORF frame 3"
     CDS             complement(907..1392)
                     /label="ORF frame 1"
     CDS             970..1587
                     /label="ORF frame 1"
     misc_feature    2226..2417
     misc_feature    complement(2411..2433)
     gene            complement(3606..4466)
     CDS             complement(3606..4466)
                     /label="ORF frame 2"
     promoter        complement(4508..4536)

Product is for research use only!



Search name

pET-12a,Plasmid pET-12a,pET-12a vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
