pET- 12c


  • Model: PVT0052
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT0052  2ug

pET-12c Informaiton

Promoter: T7/lac

Replicon: ColE1 ori

Terminator: T7 Terminator

Plasmid classification: Escherichia coli vector; PET series expression plasmid

Plasmid size: 4675bp

Plasmid tagging: N-ompT

Prokaryotic resistance: ampicillin Amp

Clonal strain: DH5 alpha

Culture conditions: 37 C, aerobic, LB

Expression host: BL21 (DE3)

Culture conditions: 37 C, aerobic, LB

Induction: IPTG or lactose and its analogues.

5'sequencing primers: T7:TAATACGACTCACTATAGGG

3'sequencing primers: T7-ter:TGCTAGTTATTGCTCAGCGG

Remarks: secreted expression


pET-12c Description

The pET-12a-c vectors carry an N-terminal ompT sequence for potential periplasmic export of target proteins. Unique sites are shown on the circle map. Note that the sequence is numbered by the pBR322 convention, so the T7 expression region is reversed on the circular map. The cloning/ expression region of the coding strand transcribed by T7 RNA polymerase is shown below.


pET-12c Multiple cloning site




pET-12c Sequence

LOCUS       Exported File           4675 bp ds-DNA    circular SYN 31-5-2015
KEYWORDS    Untitled
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4675)
  TITLE     Direct Submission
  JOURNAL   Exported 2015-5-31  
FEATURES             Location/Qualifiers
     source          1..4675
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     promoter        10..38
                     /note="tet promoter"
                     /note="E. coli promoter for tetracycline efflux protein
     terminator      404..451
                     /note="T7 terminator"
                     /note="transcription terminator for bacteriophage T7 RNA
     promoter        complement(644..662)
                     /note="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     CDS             2227..2418
                     /product="Rop protein, which maintains plasmids at low copy
     misc_feature    2520..2662
                     /note="basis of mobility region from pBR322"
     rep_origin      complement(2848..3436)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     CDS             complement(3607..4467)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     promoter        complement(4468..4572)
                     /note="AmpR promoter"

        1 ttctcatgtt tgacagctta tcatcgataa gctttaatgc ggtagtttat cacagttaaa
       61 ttgctaacgc agtcaggcac cgtgtatgaa atctaacaat gcgctcatcg tcatcctcgg
      121 caccgtcacc ctggatgctg taggcatagg cttggttatg ccggtactgc cgggcctctt
      181 gcgggatatc gtccattccg acagcatcgc cagtcactat ggcgtgctgc tagcgctata
      241 tgcgttgatg caatttctat gcgcacccgt tctcggagca ctgtccgacc gctttggccg
      301 ccgcccagtc ctgctcgctt cgctacttgg agccactatc gactacgcga tcatggcgac
      361 cacacccgtc ctgtggatat ccggatatag ttcctccttt cagcaaaaaa cccctcaaga
      421 cccgtttaga ggccccaagg ggttatgcta gttattgctc agcggtggca gcagccaact
      481 cagcttcctt tcgggctttg ttagcagccg gatccccgtc gacgcaaaag agctgatcgc
      541 gataggggtt gtcaggacta ttcctaggag tttcgcccgc atatgtatat ctccttctta
      601 aagttaaaca aaattatttc tagagggaaa ccgttgtggt ctccctatag tgagtcgtat
      661 taatttcgcg ggatcgagat ctcgatcctc tacgccggac gcatcgtggc cggcatcacc
      721 ggcgccacag gtgcggttgc tggcgcctat atcgccgaca tcaccgatgg ggaagatcgg
      781 gctcgccact tcgggctcat gagcgcttgt ttcggcgtgg gtatggtggc aggccccgtg
      841 gccgggggac tgttgggcgc catctccttg catgcaccat tccttgcggc ggcggtgctc
      901 aacggcctca acctactact gggctgcttc ctaatgcagg agtcgcataa gggagagcgt
      961 cgatcgaccg atgcccttga gagccttcaa cccagtcagc tccttccggt gggcgcgggg
     1021 catgactatc gtcgccgcac ttatgactgt cttctttatc atgcaactcg taggacaggt
     1081 gccggcagcg ctctgggtca ttttcggcga ggaccgcttt cgctggagcg cgacgatgat
     1141 cggcctgtcg cttgcggtat tcggaatctt gcacgccctc gctcaagcct tcgtcactgg
     1201 tcccgccacc aaacgtttcg gcgagaagca ggccattatc gccggcatgg cggccgacgc
     1261 gctgggctac gtcttgctgg cgttcgcgac gcgaggctgg atggccttcc ccattatgat
     1321 tcttctcgct tccggcggca tcgggatgcc cgcgttgcag gccatgctgt ccaggcaggt
     1381 agatgacgac catcagggac agcttcaagg atcgctcgcg gctcttacca gcctaacttc
     1441 gatcactgga ccgctgatcg tcacggcgat ttatgccgcc tcggcgagca catggaacgg
     1501 gttggcatgg attgtaggcg ccgccctata ccttgtctgc ctccccgcgt tgcgtcgcgg
     1561 tgcatggagc cgggccacct cgacctgaat ggaagccggc ggcacctcgc taacggattc
     1621 accactccaa gaattggagc caatcaattc ttgcggagaa ctgtgaatgc gcaaaccaac
     1681 ccttggcaga acatatccat cgcgtccgcc atctccagca gccgcacgcg gcgcatctcg
     1741 ggcagcgttg ggtcctggcc acgggtgcgc atgatcgtgc tcctgtcgtt gaggacccgg
     1801 ctaggctggc ggggttgcct tactggttag cagaatgaat caccgatacg cgagcgaacg
     1861 tgaagcgact gctgctgcaa aacgtctgcg acctgagcaa caacatgaat ggtcttcggt
     1921 ttccgtgttt cgtaaagtct ggaaacgcgg aagtcagcgc cctgcaccat tatgttccgg
     1981 atctgcatcg caggatgctg ctggctaccc tgtggaacac ctacatctgt attaacgaag
     2041 cgctggcatt gaccctgagt gatttttctc tggtcccgcc gcatccatac cgccagttgt
     2101 ttaccctcac aacgttccag taaccgggca tgttcatcat cagtaacccg tatcgtgagc
     2161 atcctctctc gtttcatcgg tatcattacc cccatgaaca gaaatccccc ttacacggag
     2221 gcatcagtga ccaaacagga aaaaaccgcc cttaacatgg cccgctttat cagaagccag
     2281 acattaacgc ttctggagaa actcaacgag ctggacgcgg atgaacaggc agacatctgt
     2341 gaatcgcttc acgaccacgc tgatgagctt taccgcagct gcctcgcgcg tttcggtgat
     2401 gacggtgaaa acctctgaca catgcagctc ccggagacgg tcacagcttg tctgtaagcg
     2461 gatgccggga gcagacaagc ccgtcagggc gcgtcagcgg gtgttggcgg gtgtcggggc
     2521 gcagccatga cccagtcacg tagcgatagc ggagtgtata ctggcttaac tatgcggcat
     2581 cagagcagat tgtactgaga gtgcaccata tatgcggtgt gaaataccgc acagatgcgt
     2641 aaggagaaaa taccgcatca ggcgctcttc cgcttcctcg ctcactgact cgctgcgctc
     2701 ggtcgttcgg ctgcggcgag cggtatcagc tcactcaaag gcggtaatac ggttatccac
     2761 agaatcaggg gataacgcag gaaagaacat gtgagcaaaa ggccagcaaa aggccaggaa
     2821 ccgtaaaaag gccgcgttgc tggcgttttt ccataggctc cgcccccctg acgagcatca
     2881 caaaaatcga cgctcaagtc agaggtggcg aaacccgaca ggactataaa gataccaggc
     2941 gtttccccct ggaagctccc tcgtgcgctc tcctgttccg accctgccgc ttaccggata
     3001 cctgtccgcc tttctccctt cgggaagcgt ggcgctttct catagctcac gctgtaggta
     3061 tctcagttcg gtgtaggtcg ttcgctccaa gctgggctgt gtgcacgaac cccccgttca
     3121 gcccgaccgc tgcgccttat ccggtaacta tcgtcttgag tccaacccgg taagacacga
     3181 cttatcgcca ctggcagcag ccactggtaa caggattagc agagcgaggt atgtaggcgg
     3241 tgctacagag ttcttgaagt ggtggcctaa ctacggctac actagaagga cagtatttgg
     3301 tatctgcgct ctgctgaagc cagttacctt cggaaaaaga gttggtagct cttgatccgg
     3361 caaacaaacc accgctggta gcggtggttt ttttgtttgc aagcagcaga ttacgcgcag
     3421 aaaaaaagga tctcaagaag atcctttgat cttttctacg gggtctgacg ctcagtggaa
     3481 cgaaaactca cgttaaggga ttttggtcat gagattatca aaaaggatct tcacctagat
     3541 ccttttaaat taaaaatgaa gttttaaatc aatctaaagt atatatgagt aaacttggtc
     3601 tgacagttac caatgcttaa tcagtgaggc acctatctca gcgatctgtc tatttcgttc
     3661 atccatagtt gcctgactcc ccgtcgtgta gataactacg atacgggagg gcttaccatc
     3721 tggccccagt gctgcaatga taccgcgaga cccacgctca ccggctccag atttatcagc
     3781 aataaaccag ccagccggaa gggccgagcg cagaagtggt cctgcaactt tatccgcctc
     3841 catccagtct attaattgtt gccgggaagc tagagtaagt agttcgccag ttaatagttt
     3901 gcgcaacgtt gttgccattg ctgcaggcat cgtggtgtca cgctcgtcgt ttggtatggc
     3961 ttcattcagc tccggttccc aacgatcaag gcgagttaca tgatccccca tgttgtgcaa
     4021 aaaagcggtt agctccttcg gtcctccgat cgttgtcaga agtaagttgg ccgcagtgtt
     4081 atcactcatg gttatggcag cactgcataa ttctcttact gtcatgccat ccgtaagatg
     4141 cttttctgtg actggtgagt actcaaccaa gtcattctga gaatagtgta tgcggcgacc
     4201 gagttgctct tgcccggcgt caacacggga taataccgcg ccacatagca gaactttaaa
     4261 agtgctcatc attggaaaac gttcttcggg gcgaaaactc tcaaggatct taccgctgtt
     4321 gagatccagt tcgatgtaac ccactcgtgc acccaactga tcttcagcat cttttacttt
     4381 caccagcgtt tctgggtgag caaaaacagg aaggcaaaat gccgcaaaaa agggaataag
     4441 ggcgacacgg aaatgttgaa tactcatact cttccttttt caatattatt gaagcattta
     4501 tcagggttat tgtctcatga gcggatacat atttgaatgt atttagaaaa ataaacaaat
     4561 aggggttccg cgcacatttc cccgaaaagt gccacctgac gtctaagaaa ccattattat
     4621 catgacatta acctataaaa ataggcgtat cacgaggccc tttcgtcttc aagaa


Search name

pET-12c,Plasmid pET-12c,pET-12c vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
