pET- 14b


  • Model: PVT0053
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT0053      2ug

pET-14b information

Promoter: T7/lac
Replicon: ColE1 ori
Terminator: T7 Terminator
Plasmid classification: Escherichia coli vector; PET series expression plasmid
Plasmid size: 4671bp
Plasmid label: N-His, N-thrombin
Prokaryotic resistance: ampicillin Amp
Cloned strain: DH5 alpha
Culture conditions: 37 centigrade, aerobic, LB
Expression host: BL21 (DE3)
Culture conditions: 37 centigrade, aerobic, LB
Inducement: IPTG or lactose and its analogues
5'sequencing primers: T7:TAATACGACTCACTATAGGG
3'sequencing primers: T7-ter:TGCTAGTTATTGCTCAGCGG
Use:pET Plasmid


pET-14b description

The pET-14b vector carries an N-terminal His•Tag® sequence followed by a thrombin site and three cloning sites. Unique sites are shown on the circle map. Note that thesequence is numbered by the pBR322 convention, so the T7 expression region is reversed on the circular map. The cloning/expression region of the coding strand transcribed by T7 RNA polymerase is shown below.


pET-14b Sequence

LOCUS       Exported                4671 bp ds-DNA     circular SYN 30-7-2015
DEFINITION  synthetic circular DNA
KEYWORDS    Untitled
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4671)
  TITLE     Direct Submission
  JOURNAL   Exported 2015-7-30
FEATURES             Location/Qualifiers
     source          1..4671
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     source          590..612
                     /organism="Enterobacteria phage T7"
                     /mol_type="genomic DNA"
     promoter        10..38
                     /note="tet promoter"
                     /note="E. coli promoter for tetracycline efflux protein
     terminator      404..451
                     /note="T7 terminator"
                     /note="transcription terminator for bacteriophage T7 RNA
     CDS             complement(527..544)
                     /product="thrombin recognition and cleavage site"
                     /note="thrombin site"
     CDS             complement(554..571)
                     /product="6xHis affinity tag"
     RBS             590..612
                     /note="efficient ribosome binding site from bacteriophage
                     T7 gene 10 (Olins and Rangwala, 1989)"
     promoter        complement(644..662)
                     /note="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     CDS             2223..2414
                     /product="Rop protein, which maintains plasmids at low copy
     misc_feature    2516..2658
                     /note="basis of mobility region from pBR322"
     rep_origin      complement(2844..3432)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     CDS             complement(3603..4463)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     promoter        complement(4464..4568)
                     /note="AmpR promoter"
        1 ttctcatgtt tgacagctta tcatcgataa gctttaatgc ggtagtttat cacagttaaa
       61 ttgctaacgc agtcaggcac cgtgtatgaa atctaacaat gcgctcatcg tcatcctcgg
      121 caccgtcacc ctggatgctg taggcatagg cttggttatg ccggtactgc cgggcctctt
      181 gcgggatatc gtccattccg acagcatcgc cagtcactat ggcgtgctgc tagcgctata
      241 tgcgttgatg caatttctat gcgcacccgt tctcggagca ctgtccgacc gctttggccg
      301 ccgcccagtc ctgctcgctt cgctacttgg agccactatc gactacgcga tcatggcgac
      361 cacacccgtc ctgtggatat ccggatatag ttcctccttt cagcaaaaaa cccctcaaga
      421 cccgtttaga ggccccaagg ggttatgcta gttattgctc agcggtggca gcagccaact
      481 cagcttcctt tcgggctttg ttagcagccg gatcctcgag catatggctg ccgcgcggca
      541 ccaggccgct gctgtgatga tgatgatgat ggctgctgcc catggtatat ctccttctta
      601 aagttaaaca aaattatttc tagagggaaa ccgttgtggt ctccctatag tgagtcgtat
      661 taatttcgcg ggatcgagat ctcgatcctc tacgccggac gcatcgtggc cggcatcacc
      721 ggcgccacag gtgcggttgc tggcgcctat atcgccgaca tcaccgatgg ggaagatcgg
      781 gctcgccact tcgggctcat gagcgcttgt ttcggcgtgg gtatggtggc aggccccgtg
      841 gccgggggac tgttgggcgc catctccttg catgcaccat tccttgcggc ggcggtgctc
      901 aacggcctca acctactact gggctgcttc ctaatgcagg agtcgcataa gggagagcgt
      961 cgaccgatgc ccttgagagc cttcaaccca gtcagctcct tccggtgggc gcggggcatg
     1021 actatcgtcg ccgcacttat gactgtcttc tttatcatgc aactcgtagg acaggtgccg
     1081 gcagcgctct gggtcatttt cggcgaggac cgctttcgct ggagcgcgac gatgatcggc
     1141 ctgtcgcttg cggtattcgg aatcttgcac gccctcgctc aagccttcgt cactggtccc
     1201 gccaccaaac gtttcggcga gaagcaggcc attatcgccg gcatggcggc cgacgcgctg
     1261 ggctacgtct tgctggcgtt cgcgacgcga ggctggatgg ccttccccat tatgattctt
     1321 ctcgcttccg gcggcatcgg gatgcccgcg ttgcaggcca tgctgtccag gcaggtagat
     1381 gacgaccatc agggacagct tcaaggatcg ctcgcggctc ttaccagcct aacttcgatc
     1441 actggaccgc tgatcgtcac ggcgatttat gccgcctcgg cgagcacatg gaacgggttg
     1501 gcatggattg taggcgccgc cctatacctt gtctgcctcc ccgcgttgcg tcgcggtgca
     1561 tggagccggg ccacctcgac ctgaatggaa gccggcggca cctcgctaac ggattcacca
     1621 ctccaagaat tggagccaat caattcttgc ggagaactgt gaatgcgcaa accaaccctt
     1681 ggcagaacat atccatcgcg tccgccatct ccagcagccg cacgcggcgc atctcgggca
     1741 gcgttgggtc ctggccacgg gtgcgcatga tcgtgctcct gtcgttgagg acccggctag
     1801 gctggcgggg ttgccttact ggttagcaga atgaatcacc gatacgcgag cgaacgtgaa
     1861 gcgactgctg ctgcaaaacg tctgcgacct gagcaacaac atgaatggtc ttcggtttcc
     1921 gtgtttcgta aagtctggaa acgcggaagt cagcgccctg caccattatg ttccggatct
     1981 gcatcgcagg atgctgctgg ctaccctgtg gaacacctac atctgtatta acgaagcgct
     2041 ggcattgacc ctgagtgatt tttctctggt cccgccgcat ccataccgcc agttgtttac
     2101 cctcacaacg ttccagtaac cgggcatgtt catcatcagt aacccgtatc gtgagcatcc
     2161 tctctcgttt catcggtatc attaccccca tgaacagaaa tcccccttac acggaggcat
     2221 cagtgaccaa acaggaaaaa accgccctta acatggcccg ctttatcaga agccagacat
     2281 taacgcttct ggagaaactc aacgagctgg acgcggatga acaggcagac atctgtgaat
     2341 cgcttcacga ccacgctgat gagctttacc gcagctgcct cgcgcgtttc ggtgatgacg
     2401 gtgaaaacct ctgacacatg cagctcccgg agacggtcac agcttgtctg taagcggatg
     2461 ccgggagcag acaagcccgt cagggcgcgt cagcgggtgt tggcgggtgt cggggcgcag
     2521 ccatgaccca gtcacgtagc gatagcggag tgtatactgg cttaactatg cggcatcaga
     2581 gcagattgta ctgagagtgc accatatatg cggtgtgaaa taccgcacag atgcgtaagg
     2641 agaaaatacc gcatcaggcg ctcttccgct tcctcgctca ctgactcgct gcgctcggtc
     2701 gttcggctgc ggcgagcggt atcagctcac tcaaaggcgg taatacggtt atccacagaa
     2761 tcaggggata acgcaggaaa gaacatgtga gcaaaaggcc agcaaaaggc caggaaccgt
     2821 aaaaaggccg cgttgctggc gtttttccat aggctccgcc cccctgacga gcatcacaaa
     2881 aatcgacgct caagtcagag gtggcgaaac ccgacaggac tataaagata ccaggcgttt
     2941 ccccctggaa gctccctcgt gcgctctcct gttccgaccc tgccgcttac cggatacctg
     3001 tccgcctttc tcccttcggg aagcgtggcg ctttctcata gctcacgctg taggtatctc
     3061 agttcggtgt aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc cgttcagccc
     3121 gaccgctgcg ccttatccgg taactatcgt cttgagtcca acccggtaag acacgactta
     3181 tcgccactgg cagcagccac tggtaacagg attagcagag cgaggtatgt aggcggtgct
     3241 acagagttct tgaagtggtg gcctaactac ggctacacta gaaggacagt atttggtatc
     3301 tgcgctctgc tgaagccagt taccttcgga aaaagagttg gtagctcttg atccggcaaa
     3361 caaaccaccg ctggtagcgg tggttttttt gtttgcaagc agcagattac gcgcagaaaa
     3421 aaaggatctc aagaagatcc tttgatcttt tctacggggt ctgacgctca gtggaacgaa
     3481 aactcacgtt aagggatttt ggtcatgaga ttatcaaaaa ggatcttcac ctagatcctt
     3541 ttaaattaaa aatgaagttt taaatcaatc taaagtatat atgagtaaac ttggtctgac
     3601 agttaccaat gcttaatcag tgaggcacct atctcagcga tctgtctatt tcgttcatcc
     3661 atagttgcct gactccccgt cgtgtagata actacgatac gggagggctt accatctggc
     3721 cccagtgctg caatgatacc gcgagaccca cgctcaccgg ctccagattt atcagcaata
     3781 aaccagccag ccggaagggc cgagcgcaga agtggtcctg caactttatc cgcctccatc
     3841 cagtctatta attgttgccg ggaagctaga gtaagtagtt cgccagttaa tagtttgcgc
     3901 aacgttgttg ccattgctgc aggcatcgtg gtgtcacgct cgtcgtttgg tatggcttca
     3961 ttcagctccg gttcccaacg atcaaggcga gttacatgat cccccatgtt gtgcaaaaaa
     4021 gcggttagct ccttcggtcc tccgatcgtt gtcagaagta agttggccgc agtgttatca
     4081 ctcatggtta tggcagcact gcataattct cttactgtca tgccatccgt aagatgcttt
     4141 tctgtgactg gtgagtactc aaccaagtca ttctgagaat agtgtatgcg gcgaccgagt
     4201 tgctcttgcc cggcgtcaac acgggataat accgcgccac atagcagaac tttaaaagtg
     4261 ctcatcattg gaaaacgttc ttcggggcga aaactctcaa ggatcttacc gctgttgaga
     4321 tccagttcga tgtaacccac tcgtgcaccc aactgatctt cagcatcttt tactttcacc
     4381 agcgtttctg ggtgagcaaa aacaggaagg caaaatgccg caaaaaaggg aataagggcg
     4441 acacggaaat gttgaatact catactcttc ctttttcaat attattgaag catttatcag
     4501 ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg
     4561 gttccgcgca catttccccg aaaagtgcca cctgacgtct aagaaaccat tattatcatg
     4621 acattaacct ataaaaatag gcgtatcacg aggccctttc gtcttcaaga a

Product is for research use only!


​​​​​​​Search name

pET-14b,Plasmid pET-14b,pET-14b vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
