pET- 17b


  • Model: PVT0056
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pET-17b,Plasmid pET-17b,pET-17b vector



pET-17b Information

Promoter: T7

Replicon: ColE1 ori

Terminator: T7 Terminator

Plasmid classification: large intestine plasmid; large intestine expression plasmid; pET series plasmid.

Plasmid size: 3306bp

Plasmid tagging: N-T7

Prokaryotic resistance: ampicillin Amp (100 g/ml)

Cloning strains: E. coli DH5 and E.

Culture conditions: 37 C, aerobic, LB

Expression host: E. coli BL21 (DE3).

Culture conditions: 37 C, aerobic, LB

Induction: IPTG or lactose and its analogues.

5'sequencing primers: T7 (TAATACGACTCACTATAGGG)

3'sequencing primers: T7-ter (TGCTAGTTATTGCTCAGCGG)


pET-17b Description

PET-17b plasmid is a prokaryotic expression vector, and the N end contains a T7 tag. The plasmid contains several commonly used restriction sites to facilitate cloning of different genes. The expression was induced by T7 RNA polymerase provided by host cells. The target gene was cloned into plasmid vector and controlled by strong transcription and translation signals of bacteriophages.

PET system is the most powerful system to express recombinant proteins in E. coli, and it is also the most widely used system in prokaryotic expression nowadays. The plasmids can easily reduce protein expression by decreasing the concentration of inducers. Under non inducible conditions, the target gene can be completely silenced without transcribing.


The pET-17b vector carries an N-terminal 11aa T7?Tag? sequence followed by a region of useful cloning sites. Included in the multiple cloning region are dual BstX I sites, which allow efficient cloning using an asymmetric linker. Unique sites (except for the two BstX I sites) are shown on the circle map. Note that the sequence is numbered by the pBR322 convention, so the T7 expression region is reversed on the circluar map. The cloning/expression region of the coding strand transcribed by T7 RNA polymerase is shown below.


pET-17b Multiple cloning site



pET-17b Sequence

LOCUS       Exported                3306 bp ds-DNA     circular SYN 15-JUN-2017
DEFINITION  synthetic circular DNA.
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 3306)
  TITLE     Direct Submission
  JOURNAL   Exported Thursday, June 15, 2017  
FEATURES             Location/Qualifiers
     source          1..3306
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     promoter        104..208
                     /note="AmpR promoter"
     CDS             209..1069
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     rep_origin      1240..1828
                     /note="high-copy-number colE1/pMB1/pBR322/pUC origin of
     CDS             complement(2258..2449)
                     /product="Rop protein"
     promoter        2958..2976
                     /note="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     CDS             3038..3070
                     /product="leader peptide from bacteriophage T7 gene 10"
                     /note="T7 tag (gene 10 leader)"
                     /note="promotes efficient translation in E. coli"
     misc_feature    3079..3166
     terminator      3232..3279
                     /note="T7 terminator"
                     /note="transcription terminator for bacteriophage T7 RNA
        1 ttcttgaaga cgaaagggcc tcgtgatacg cctattttta taggttaatg tcatgataat
       61 aatggtttct tagacgtcag gtggcacttt tcggggaaat gtgcgcggaa cccctatttg
      121 tttatttttc taaatacatt caaatatgta tccgctcatg agacaataac cctgataaat
      181 gcttcaataa tattgaaaaa ggaagagtat gagtattcaa catttccgtg tcgcccttat
      241 tccctttttt gcggcatttt gccttcctgt ttttgctcac ccagaaacgc tggtgaaagt
      301 aaaagatgct gaagatcagt tgggtgcacg agtgggttac atcgaactgg atctcaacag
      361 cggtaagatc cttgagagtt ttcgccccga agaacgtttt ccaatgatga gcacttttaa
      421 agttctgcta tgtggcgcgg tattatcccg tgttgacgcc gggcaagagc aactcggtcg
      481 ccgcatacac tattctcaga atgacttggt tgagtactca ccagtcacag aaaagcatct
      541 tacggatggc atgacagtaa gagaattatg cagtgctgcc ataaccatga gtgataacac
      601 tgcggccaac ttacttctga caacgatcgg aggaccgaag gagctaaccg cttttttgca
      661 caacatgggg gatcatgtaa ctcgccttga tcgttgggaa ccggagctga atgaagccat
      721 accaaacgac gagcgtgaca ccacgatgcc tgcagcaatg gcaacaacgt tgcgcaaact
      781 attaactggc gaactactta ctctagcttc ccggcaacaa ttaatagact ggatggaggc
      841 ggataaagtt gcaggaccac ttctgcgctc ggcccttccg gctggctggt ttattgctga
      901 taaatctgga gccggtgagc gtgggtctcg cggtatcatt gcagcactgg ggccagatgg
      961 taagccctcc cgtatcgtag ttatctacac gacggggagt caggcaacta tggatgaacg
     1021 aaatagacag atcgctgaga taggtgcctc actgattaag cattggtaac tgtcagacca
     1081 agtttactca tatatacttt agattgattt aaaacttcat ttttaattta aaaggatcta
     1141 ggtgaagatc ctttttgata atctcatgac caaaatccct taacgtgagt tttcgttcca
     1201 ctgagcgtca gaccccgtag aaaagatcaa aggatcttct tgagatcctt tttttctgcg
     1261 cgtaatctgc tgcttgcaaa caaaaaaacc accgctacca gcggtggttt gtttgccgga
     1321 tcaagagcta ccaactcttt ttccgaaggt aactggcttc agcagagcgc agataccaaa
     1381 tactgtcctt ctagtgtagc cgtagttagg ccaccacttc aagaactctg tagcaccgcc
     1441 tacatacctc gctctgctaa tcctgttacc agtggctgct gccagtggcg ataagtcgtg
     1501 tcttaccggg ttggactcaa gacgatagtt accggataag gcgcagcggt cgggctgaac
     1561 ggggggttcg tgcacacagc ccagcttgga gcgaacgacc tacaccgaac tgagatacct
     1621 acagcgtgag ctatgagaaa gcgccacgct tcccgaaggg agaaaggcgg acaggtatcc
     1681 ggtaagcggc agggtcggaa caggagagcg cacgagggag cttccagggg gaaacgcctg
     1741 gtatctttat agtcctgtcg ggtttcgcca cctctgactt gagcgtcgat ttttgtgatg
     1801 ctcgtcaggg gggcggagcc tatggaaaaa cgccagcaac gcggcctttt tacggttcct
     1861 ggccttttgc tggccttttg ctcacatgtt ctttcctgcg ttatcccctg attctgtgga
     1921 taaccgtatt accgcctttg agtgagctga taccgctcgc cgcagccgaa cgaccgagcg
     1981 cagcgagtca gtgagcgagg aagcggaaga gcgcctgatg cggtattttc tccttacgca
     2041 tctgtgcggt atttcacacc gcatatatgg tgcactctca gtacaatctg ctctgatgcc
     2101 gcatagttaa gccagtatac actccgctat cgctacgtga ctgggtcatg gctgcgcccc
     2161 gacacccgcc aacacccgct gacgcgccct gacgggcttg tctgctcccg gcatccgctt
     2221 acagacaagc tgtgaccgtc tccgggagct gcatgtgtca gaggttttca ccgtcatcac
     2281 cgaaacgcgc gaggcagctg cggtaaagct catcagcgtg gtcgtgaagc gattcacaga
     2341 tgtctgcctg ttcatccgcg tccagctcgt tgagtttctc cagaagcgtt aatgtctggc
     2401 ttctgataaa gcgggccatg ttaagggcgg ttttttcctg tttggtcact gatgcctccg
     2461 tgtaaggggg atttctgttc atgggggtaa tgataccgat gaaacgagag aggatgctca
     2521 cgatacgggt tactgatgat gaacatgccc ggttactgga acgttgtgag ggtaaacaac
     2581 tggcggtatg gatgcggcgg gaccagagaa aaatcactca gggtcaatgc cagcgcttcg
     2641 ttaatacaga tgtaggtgtt ccacagggta gccagcagca tcctgcgatg cagatccgga
     2701 acataatggt gcagggcgct gacttccgcg tttccagact ttacgaaaca cggaaaccga
     2761 agaccattca tgttgttgct caggtcgcag acgttttgca gcagcagtcg cttcacgttc
     2821 gctcgcgtat cggtgattca ttctgctaac cagtaaggca accccgccag cctagccggg
     2881 tcctcaacga caggagcacg atcatgcgca cccgtggcca ggacccaacg ctgcccgaga
     2941 tctcgatccc gcgaaattaa tacgactca

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
