pET- 23a


  • Model: PVT0066
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT0066 2ug


pET-23a Information

Promoter: T7

Replicator: ColE1 ori, F1 ori

Terminator: T7 Terminator

Plasmid classification: Escherichia coli vector; PET series expression plasmid

Plasmid size: 3666bp

Plasmid label: N-T7, C-6 x His

Prokaryotic resistance: ampicillin Amp

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic, LB

Expression host: BL21 (DE3)

Culture conditions: 37 centigrade, aerobic, LB

Induction mode: no induction

5'sequencing primers: T7:TAATACGACTCACTATAGGG

3'sequencing primers: T7-ter:TGCTAGTTATTGCTCAGCGG

Note: component expression

Use:pET Plasmid


pET-23a Sequence

LOCUS       Exported                3666 bp ds-DNA     circular SYN 31-7-2015
DEFINITION  synthetic circular DNA
KEYWORDS    Untitled 2
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 3666)
  TITLE     Direct Submission
  JOURNAL   Exported 2015-7-1  
FEATURES             Location/Qualifiers
     source          1..3666
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     source          247..269
                     /organism="Enterobacteria phage T7"
                     /mol_type="genomic DNA"
     terminator      26..73
                     /note="T7 terminator"
                     /note="transcription terminator for bacteriophage T7 RNA
     CDS             complement(140..157)
                     /product="6xHis affinity tag"
     CDS             complement(207..239)
                     /product="leader peptide from bacteriophage T7 gene 10"
                     /note="T7 tag (gene 10 leader)"
                     /note="promotes efficient translation in E. coli"
     RBS             247..269
                     /note="efficient ribosome binding site from bacteriophage
                     T7 gene 10 (Olins and Rangwala, 1989)"
     promoter        complement(301..319)
                     /note="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     CDS             828..1019
                     /product="Rop protein, which maintains plasmids at low copy
     misc_feature    1121..1263
                     /note="basis of mobility region from pBR322"
     rep_origin      complement(1449..2037)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     CDS             complement(2208..3068)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     promoter        complement(3069..3173)
                     /note="AmpR promoter"
     rep_origin      complement(3200..3655)
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
        1 atccggatat agttcctcct ttcagcaaaa aacccctcaa gacccgttta gaggccccaa
       61 ggggttatgc tagttattgc tcagcggtgg cagcagccaa ctcagcttcc tttcgggctt
      121 tgttagcagc cggatctcag tggtggtggt ggtggtgctc gagtgcggcc gcaagcttgt
      181 cgacggagct cgaattcgga tccgcgaccc atttgctgtc caccagtcat gctagccata
      241 tgtatatctc cttcttaaag ttaaacaaaa ttatttctag agggaaaccg ttgtggtctc
      301 cctatagtga gtcgtattaa tttcgcggga tcgagatctc gggcagcgtt gggtcctggc
      361 cacgggtgcg catgatcgtg ctcctgtcgt tgaggacccg gctaggctgg cggggttgcc
      421 ttactggtta gcagaatgaa tcaccgatac gcgagcgaac gtgaagcgac tgctgctgca
      481 aaacgtctgc gacctgagca acaacatgaa tggtcttcgg tttccgtgtt tcgtaaagtc
      541 tggaaacgcg gaagtcagcg ccctgcacca ttatgttccg gatctgcatc gcaggatgct
      601 gctggctacc ctgtggaaca cctacatctg tattaacgaa gcgctggcat tgaccctgag
      661 tgatttttct ctggtcccgc cgcatccata ccgccagttg tttaccctca caacgttcca
      721 gtaaccgggc atgttcatca tcagtaaccc gtatcgtgag catcctctct cgtttcatcg
      781 gtatcattac ccccatgaac agaaatcccc cttacacgga ggcatcagtg accaaacagg
      841 aaaaaaccgc ccttaacatg gcccgcttta tcagaagcca gacattaacg cttctggaga
      901 aactcaacga gctggacgcg gatgaacagg cagacatctg tgaatcgctt cacgaccacg
      961 ctgatgagct ttaccgcagc tgcctcgcgc gtttcggtga tgacggtgaa aacctctgac
     1021 acatgcagct cccggagacg gtcacagctt gtctgtaagc ggatgccggg agcagacaag
     1081 cccgtcaggg cgcgtcagcg ggtgttggcg ggtgtcgggg cgcagccatg acccagtcac
     1141 gtagcgatag cggagtgtat actggcttaa ctatgcggca tcagagcaga ttgtactgag
     1201 agtgcaccat atatgcggtg tgaaataccg cacagatgcg taaggagaaa ataccgcatc
     1261 aggcgctctt ccgcttcctc gctcactgac tcgctgcgct cggtcgttcg gctgcggcga
     1321 gcggtatcag ctcactcaaa ggcggtaata cggttatcca cagaatcagg ggataacgca
     1381 ggaaagaaca tgtgagcaaa aggccagcaa aaggccagga accgtaaaaa ggccgcgttg
     1441 ctggcgtttt tccataggct ccgcccccct gacgagcatc acaaaaatcg acgctcaagt
     1501 cagaggtggc gaaacccgac aggactataa agataccagg cgtttccccc tggaagctcc
     1561 ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat acctgtccgc ctttctccct
     1621 tcgggaagcg tggcgctttc tcatagctca cgctgtaggt atctcagttc ggtgtaggtc
     1681 gttcgctcca agctgggctg tgtgcacgaa ccccccgttc agcccgaccg ctgcgcctta
     1741 tccggtaact atcgtcttga gtccaacccg gtaagacacg acttatcgcc actggcagca
     1801 gccactggta acaggattag cagagcgagg tatgtaggcg gtgctacaga gttcttgaag
     1861 tggtggccta actacggcta cactagaagg acagtatttg gtatctgcgc tctgctgaag
     1921 ccagttacct tcggaaaaag agttggtagc tcttgatccg gcaaacaaac caccgctggt
     1981 agcggtggtt tttttgtttg caagcagcag attacgcgca gaaaaaaagg atctcaagaa
     2041 gatcctttga tcttttctac ggggtctgac gctcagtgga acgaaaactc acgttaaggg
     2101 attttggtca tgagattatc aaaaaggatc ttcacctaga tccttttaaa ttaaaaatga
     2161 agttttaaat caatctaaag tatatatgag taaacttggt ctgacagtta ccaatgctta
     2221 atcagtgagg cacctatctc agcgatctgt ctatttcgtt catccatagt tgcctgactc
     2281 cccgtcgtgt agataactac gatacgggag ggcttaccat ctggccccag tgctgcaatg
     2341 ataccgcgag acccacgctc accggctcca gatttatcag caataaacca gccagccgga
     2401 agggccgagc gcagaagtgg tcctgcaact ttatccgcct ccatccagtc tattaattgt
     2461 tgccgggaag ctagagtaag tagttcgcca gttaatagtt tgcgcaacgt tgttgccatt
     2521 gctgcaggca tcgtggtgtc acgctcgtcg tttggtatgg cttcattcag ctccggttcc
     2581 caacgatcaa ggcgagttac atgatccccc atgttgtgca aaaaagcggt tagctccttc
     2641 ggtcctccga tcgttgtcag aagtaagttg gccgcagtgt tatcactcat ggttatggca
     2701 gcactgcata attctcttac tgtcatgcca tccgtaagat gcttttctgt gactggtgag
     2761 tactcaacca agtcattctg agaatagtgt atgcggcgac cgagttgctc ttgcccggcg
     2821 tcaatacggg ataataccgc gccacatagc agaactttaa aagtgctcat cattggaaaa
     2881 cgttcttcgg ggcgaaaact ctcaaggatc ttaccgctgt tgagatccag ttcgatgtaa
     2941 cccactcgtg cacccaactg atcttcagca tcttttactt tcaccagcgt ttctgggtga
     3001 gcaaaaacag gaaggcaaaa tgccgcaaaa aagggaataa gggcgacacg gaaatgttga
     3061 atactcatac tcttcctttt tcaatattat tgaagcattt atcagggtta ttgtctcatg
     3121 agcggataca tatttgaatg tatttagaaa aataaacaaa taggggttcc gcgcacattt
     3181 ccccgaaaag tgccacctga aattgtaaac gttaatattt tgttaaaatt cgcgttaaat
     3241 ttttgttaaa tcagctcatt ttttaaccaa taggccgaaa tcggcaaaat cccttataaa
     3301 tcaaaagaat agaccgagat agggttgagt gttgttccag tttggaacaa gagtccacta
     3361 ttaaagaacg tggactccaa cgtcaaaggg cgaaaaaccg tctatcaggg cgatggccca
     3421 ctacgtgaac catcacccta atcaagtttt ttggggtcga ggtgccgtaa agcactaaat
     3481 cggaacccta aagggagccc ccgatttaga gcttgacggg gaaagccggc gaacgtggcg
     3541 agaaaggaag ggaagaaagc gaaaggagcg ggcgctaggg cgctggcaag tgtagcggtc
     3601 acgctgcgcg taaccaccac acccgccgcg cttaatgcgc cgctacaggg cgcgtcccat
     3661 tcgcca


Search name

pET-23a,Plasmid pET-23a,pET-23a vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
