pET- 26b

$162.00

  • Model: PVT0070
  • 50 Units in Stock
Ask a question


Add to Cart:

pET-26b

Search name

pET-26b,Plasmid pET-26b,pET-26b vector

pET-26b Plasmid informaiton

Promoter: T7/lac
Replicon: ColE1 ori, F1 ori
Terminator: T7 Terminator
Plasmid classification: Escherichia coli plasmid; E.coli expression plasmid; pET plasmid
Plasmid size: 5360bp
Plasmid Tags: C-6 * His
Prokaryotic resistance: kanamycin Kan (50 g/ml)
Clone strain: DH5 alpha and other Escherichia coli
Culture conditions: 37, aerobic, LB
Expression host: BL21 (DE3) and other Escherichia coli
Culture conditions: 37, aerobic, LB
Induction: IPTG or lactose and its analogues
Primers for 5'sequencing: T7 (TAATACGACTCACTATAGGG)
3'sequencing primer: T7-ter (TGCTAGTTATTGCTCAGCGG)
Remark: secretory expression
Use:pET Plasmid

pET-26b

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart