pET- 28b


  • Model: PVT0081
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT0081 2ug

pET-28b Information

Promoter: T7/laco promoter

Copier: ColE1 ori, F1ori

Terminator: T7 Terminator

Plasmid Classification: E. coli Vector; PET Series Expression Plasmid

Plasmid size: 5368 BP

Plasmid labels: N-6 *His, N-Thrombin, N-T7, C-6 *His

Prokaryotic resistance: kanamycin Kan

Cloning strain: Escherichia coli DH5alpha

Culture conditions: 37 C, aerobic, LB

Expression host: Escherichia coli BL21 (DE3)

Culture conditions: 37 C, aerobic, LB

Induction: IPTG or lactose and its analogues

5'Sequencing Primers: T7: TAATACGACTCACTATAGG

3'Sequencing primers: T7-ter: TGCTAGTTATTGCTCAGCGG

Use:pET Plasmid


pET-28b Description

pET-28b contains an N-terminal His/Thrombin/T7 protein tag and an optional C-terminal His tag. The single polyclonal site of pET28b vector is shown in the circular plasmid map above. Note: The vector sequence is encoded by the coding rules of the pBR322 plasmid, so the expression region of T7 protein is reversed on the plasmid map. The cloning and expression regions initiated by T7 RNA polymerase were also labeled in the plasmid map. The F1 replicon of the plasmid is directed, so viral particles containing protein coding sequence can be produced by T7 phage polymerase, and the protein expression will be terminated by T7 terminator sequence.


pET-28b Sequence

LOCUS       Exported                5368 bp ds-DNA     circular SYN 03-8-2015
DEFINITION  synthetic circular DNA
KEYWORDS    Untitled
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 5368)
  TITLE     Direct Submission
  JOURNAL   Exported 2015-8-3  
FEATURES             Location/Qualifiers
     source          1..5368
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     source          305..327
                     /organism="Enterobacteria phage T7"
                     /mol_type="genomic DNA"
     terminator      26..73
                     /note="T7 terminator"
                     /note="transcription terminator for bacteriophage T7 RNA
     CDS             complement(140..157)
                     /product="6xHis affinity tag"
     CDS             complement(206..238)
                     /product="leader peptide from bacteriophage T7 gene 10"
                     /note="T7 tag (gene 10 leader)"
                     /note="promotes efficient translation in E. coli"
     CDS             complement(242..259)
                     /product="thrombin recognition and cleavage site"
                     /note="thrombin site"
     CDS             complement(269..286)
                     /product="6xHis affinity tag"
     RBS             305..327
                     /note="efficient ribosome binding site from bacteriophage
                     T7 gene 10 (Olins and Rangwala, 1989)"
     protein_bind    342..366
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(367..385)
                     /note="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     promoter        694..771
                     /note="lacI promoter"
     CDS             772..1854
                     /product="lac repressor"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     CDS             2663..2854
                     /product="Rop protein, which maintains plasmids at low copy
     misc_feature    2956..3098
                     /note="basis of mobility region from pBR322"
     rep_origin      complement(3284..3872)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     CDS             3994..4809
                     /product="aminoglycoside phosphotransferase"
                     /note="confers resistance to kanamycin in bacteria or G418
                     (Geneticin(R)) in eukaryotes"
     rep_origin      complement(4902..5357)
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
        1 atccggatat agttcctcct ttcagcaaaa aacccctcaa gacccgttta gaggccccaa
       61 ggggttatgc tagttattgc tcagcggtgg cagcagccaa ctcagcttcc tttcgggctt
      121 tgttagcagc cggatctcag tggtggtggt ggtggtgctc gagtgcggcc gcaagcttgt
      181 cgacggagct cgaattcgga tcccgaccca tttgctgtcc accagtcatg ctagccatat
      241 ggctgccgcg cggcaccagg ccgctgctgt gatgatgatg atgatggctg ctgcccatgg
      301 tatatctcct tcttaaagtt aaacaaaatt atttctagag gggaattgtt atccgctcac
      361 aattccccta tagtgagtcg tattaatttc gcgggatcga gatctcgatc ctctacgccg
      421 gacgcatcgt ggccggcatc accggcgcca caggtgcggt tgctggcgcc tatatcgccg
      481 acatcaccga tggggaagat cgggctcgcc acttcgggct catgagcgct tgtttcggcg
      541 tgggtatggt ggcaggcccc gtggccgggg gactgttggg cgccatctcc ttgcatgcac
      601 cattccttgc ggcggcggtg ctcaacggcc tcaacctact actgggctgc ttcctaatgc
      661 aggagtcgca taagggagag cgtcgagatc ccggacacca tcgaatggcg caaaaccttt
      721 cgcggtatgg catgatagcg cccggaagag agtcaattca gggtggtgaa tgtgaaacca
      781 gtaacgttat acgatgtcgc agagtatgcc ggtgtctctt atcagaccgt ttcccgcgtg
      841 gtgaaccagg ccagccacgt ttctgcgaaa acgcgggaaa aagtggaagc ggcgatggcg
      901 gagctgaatt acattcccaa ccgcgtggca caacaactgg cgggcaaaca gtcgttgctg
      961 attggcgttg ccacctccag tctggccctg cacgcgccgt cgcaaattgt cgcggcgatt
     1021 aaatctcgcg ccgatcaact gggtgccagc gtggtggtgt cgatggtaga acgaagcggc
     1081 gtcgaagcct gtaaagcggc ggtgcacaat cttctcgcgc aacgcgtcag tgggctgatc
     1141 attaactatc cgctggatga ccaggatgcc attgctgtgg aagctgcctg cactaatgtt
     1201 ccggcgttat ttcttgatgt ctctgaccag acacccatca acagtattat tttctcccat
     1261 gaagacggta cgcgactggg cgtggagcat ctggtcgcat tgggtcacca gcaaatcgcg
     1321 ctgttagcgg gcccattaag ttctgtctcg gcgcgtctgc gtctggctgg ctggcataaa
     1381 tatctcactc gcaatcaaat tcagccgata gcggaacggg aaggcgactg gagtgccatg
     1441 tccggttttc aacaaaccat gcaaatgctg aatgagggca tcgttcccac tgcgatgctg
     1501 gttgccaacg atcagatggc gctgggcgca atgcgcgcca ttaccgagtc cgggctgcgc
     1561 gttggtgcgg atatctcggt agtgggatac gacgataccg aagacagctc atgttatatc
     1621 ccgccgttaa ccaccatcaa acaggatttt cgcctgctgg ggcaaaccag cgtggaccgc
     1681 ttgctgcaac tctctcaggg ccaggcggtg aagggcaatc agctgttgcc cgtctcactg
     1741 gtgaaaagaa aaaccaccct ggcgcccaat acgcaaaccg cctctccccg cgcgttggcc
     1801 gattcattaa tgcagctggc acgacaggtt tcccgactgg aaagcgggca gtgagcgcaa
     1861 cgcaattaat gtaagttagc tcactcatta ggcaccggga tctcgaccga tgcccttgag
     1921 agccttcaac ccagtcagct ccttccggtg ggcgcggggc atgactatcg tcgccgcact
     1981 tatgactgtc ttctttatca tgcaactcgt aggacaggtg ccggcagcgc tctgggtcat
     2041 tttcggcgag gaccgctttc gctggagcgc gacgatgatc ggcctgtcgc ttgcggtatt
     2101 cggaatcttg cacgccctcg ctcaagcctt cgtcactggt cccgccacca aacgtttcgg
     2161 cgagaagcag gccattatcg ccggcatggc ggccccacgg gtgcgcatga tcgtgctcct
     2221 gtcgttgagg acccggctag gctggcgggg ttgccttact ggttagcaga atgaatcacc
     2281 gatacgcgag cgaacgtgaa gcgactgctg ctgcaaaacg tctgcgacct gagcaacaac
     2341 atgaatggtc ttcggtttcc gtgtttcgta aagtctggaa acgcggaagt cagcgccctg
     2401 caccattatg ttccggatct gcatcgcagg atgctgctgg ctaccctgtg gaacacctac
     2461 atctgtatta acgaagcgct ggcattgacc ctgagtgatt tttctctggt cccgccgcat
     2521 ccataccgcc agttgtttac cctcacaacg ttccagtaac cgggcatgtt catcatcagt
     2581 aacccgtatc gtgagcatcc tctctcgttt catcggtatc attaccccca tgaacagaaa
     2641 tcccccttac acggaggcat cagtgaccaa acaggaaaaa accgccctta acatggcccg
     2701 ctttatcaga agccagacat taacgcttct ggagaaactc aacgagctgg acgcggatga
     2761 acaggcagac atctgtgaat cgcttcacga ccacgctgat gagctttacc gcagctgcct
     2821 cgcgcgtttc ggtgatgacg gtgaaaacct ctgacacatg cagctcccgg agacggtcac
     2881 agcttgtctg taagcggatg ccgggagcag acaagcccgt cagggcgcgt cagcgggtgt
     2941 tggcgggtgt cggggcgcag ccatgaccca gtcacgtagc gatagcggag tgtatactgg
     3001 cttaactatg cggcatcaga gcagattgta ctgagagtgc accatatatg cggtgtgaaa
     3061 taccgcacag atgcgtaagg agaaaatacc gcatcaggcg ctcttccgct tcctcgctca
     3121 ctgactcgct gcgctcggtc gttcggctgc ggcgagcggt atcagctcac tcaaaggcgg
     3181 taatacggtt atccacagaa tcaggggata acgcaggaaa gaacatgtga gcaaaaggcc
     3241 agcaaaaggc caggaaccgt aaaaaggccg cgttgctggc gtttttccat aggctccgcc
     3301 cccctgacga gcatcacaaa aatcgacgct caagtcagag gtggcgaaac ccgacaggac
     3361 tataaagata ccaggcgttt ccccctggaa gctccctcgt gcgctctcct gttccgaccc
     3421 tgccgcttac cggatacctg tccgcctttc tcccttcggg aagcgtggcg ctttctcata
     3481 gctcacgctg taggtatctc agttcggtgt aggtcgttcg ctccaagctg ggctgtgtgc
     3541 acgaaccccc cgttcagccc gaccgctgcg ccttatccgg taactatcgt cttgagtcca
     3601 acccggtaag acacgactta tcgccactgg cagcagccac tggtaacagg attagcagag
     3661 cgaggtatgt aggcggtgct acagagttct tgaagtggtg gcctaactac ggctacacta
     3721 gaaggacagt atttggtatc tgcgctctgc tgaagccagt taccttcgga aaaagagttg
     3781 gtagctcttg atccggcaaa caaaccaccg ctggtagcgg tggttttttt gtttgcaagc
     3841 agcagattac gcgcagaaaa aaaggatctc aagaagatcc tttgatcttt tctacggggt
     3901 ctgacgctca gtggaacgaa aactcacgtt aagggatttt ggtcatgaac aataaaactg
     3961 tctgcttaca taaacagtaa tacaaggggt gttatgagcc atattcaacg ggaaacgtct
     4021 tgctctaggc cgcgattaaa ttccaacatg gatgctgatt tatatgggta taaatgggct
     4081 cgcgataatg tcgggcaatc aggtgcgaca atctatcgat tgtatgggaa gcccgatgcg
     4141 ccagagttgt ttctgaaaca tggcaaaggt agcgttgcca atgatgttac agatgagatg
     4201 gtcagactaa actggctgac ggaatttatg cctcttccga ccatcaagca ttttatccgt
     4261 actcctgatg atgcatggtt actcaccact gcgatccccg ggaaaacagc attccaggta
     4321 ttagaagaat atcctgattc aggtgaaaat attgttgatg cgctggcagt gttcctgcgc
     4381 cggttgcatt cgattcctgt ttgtaattgt ccttttaaca gcgatcgcgt atttcgtctc
     4441 gctcaggcgc aatcacgaat gaataacggt ttggttgatg cgagtgattt tgatgacgag
     4501 cgtaatggct ggcctgttga acaagtctgg aaagaaatgc ataaactttt gccattctca
     4561 ccggattcag tcgtcactca tggtgatttc tcacttgata accttatttt tgacgagggg
     4621 aaattaatag gttgtattga tgttggacga gtcggaatcg cagaccgata ccaggatctt
     4681 gccatcctat ggaactgcct cggtgagttt tctccttcat tacagaaacg gctttttcaa
     4741 aaatatggta ttgataatcc tgatatgaat aaattgcagt ttcatttgat gctcgatgag
     4801 tttttctaag aattaattca tgagcggata catatttgaa tgtatttaga aaaataaaca
     4861 aataggggtt ccgcgcacat ttccccgaaa agtgccacct gaaattgtaa acgttaatat
     4921 tttgttaaaa ttcgcgttaa atttttgtta aatcagctca ttttttaacc aataggccga
     4981 aatcggcaaa atcccttata aatcaaaaga atagaccgag atagggttga gtgttgttcc
     5041 agtttggaac aagagtccac tattaaagaa cgtggactcc aacgtcaaag ggcgaaaaac
     5101 cgtctatcag ggcgatggcc cactacgtga accatcaccc taatcaagtt ttttggggtc
     5161 gaggtgccgt aaagcactaa atcggaaccc taaagggagc ccccgattta gagcttgacg
     5221 gggaaagccg gcgaacgtgg cgagaaagga agggaagaaa gcgaaaggag cgggcgctag
     5281 ggcgctggca agtgtagcgg tcacgctgcg cgtaaccacc acacccgccg cgcttaatgc
     5341 gccgctacag ggcgcgtccc attcgcca


Product is for research use only!


Search name

pET-28b,Plasmid pET-28b,pET-28b vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
