pET- 29a


  • Model: PVT0083
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT0083  2ug

Search name

pET-29a,Plasmid pET-29a,pET-29a vector


pET-29a Information

Promoter: T7/laco promoter

Copier: ColE1 ori, F1 ori

Terminator: T7 Terminator

Plasmid Classification: Colon Series Plasmids; Colon Expression Plasmids; pET Series Plasmids

Plasmid size: 5371bp

Plasmid label: N-S, N-Thrombin, C-6 *His

Prokaryotic resistance: kanamycin Kan (50 ug/ml)

Cloning strains: Escherichia coli such as DH5alpha

Culture conditions: 37 C, aerobic, LB

Expression host: Escherichia coli such as BL21 (DE3)

Culture conditions: 37 C, aerobic, LB

Induction: IPTG or lactose and its analogues

5'Sequencing Primer: T7 (TAATACGACTCACTATAGG)

3'Sequencing primers: T7-ter (TGCTAGTTATTGCTCAGCGG)


pET-29a Description
pET-29a plasmid is a prokaryotic expression vector. The C-terminal contains a 6*His tag, and the N-terminal contains a thrombin site and a S-tag. The plasmid contains several commonly used restriction sites, which facilitates the cloning of different genes. The expression was induced by T7 RNA polymerase provided by host cells. The target gene was cloned into plasmid vector and controlled by strong transcription and translation signals of bacteriophages.

PET system is the most powerful system to express recombinant proteins in E. coli, and it is also the most widely used system in prokaryotic expression nowadays. This series of plasmids can easily weaken the expression of protein by reducing the concentration of inducers. Under non-induced conditions, the target gene can be completely silenced without transcription.


pET-29a Sites




pET-29a Sequence

LOCUS       Exported                5371 bp ds-DNA     circular SYN 05-SEP-2016
DEFINITION  synthetic circular DNA
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 5371)
  TITLE     Direct Submission
  JOURNAL   Exported Monday, September 5, 2016 from SnapGene Viewer 3.1.4
FEATURES             Location/Qualifiers
     source          1..5371
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     terminator      26..73
                     /note="T7 terminator"
                     /note="transcription terminator for bacteriophage T7 RNA
     CDS             complement(140..157)
                     /product="6xHis affinity tag"
     CDS             complement(216..233)
                     /product="thrombin recognition and cleavage site"
                     /note="thrombin site"
     CDS             complement(249..293)
                     /product="affinity and epitope tag derived from pancreatic
                     ribonuclease A"
     protein_bind    341..365
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(366..384)
                     /note="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     promoter        697..774
                     /note="lacI promoter"
     CDS             775..1857
                     /product="lac repressor"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     CDS             2666..2857
                     /product="Rop protein"
     rep_origin      complement(3287..3875)
                     /note="high-copy-number colE1/pMB1/pBR322/pUC origin of
     CDS             3997..4812
                     /product="aminoglycoside phosphotransferase"
                     /note="confers resistance to kanamycin"
     rep_origin      complement(4905..5360)
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
        1 atccggatat agttcctcct ttcagcaaaa aacccctcaa gacccgttta gaggccccaa
       61 ggggttatgc tagttattgc tcagcggtgg cagcagccaa ctcagcttcc tttcgggctt
      121 tgttagcagc cggatctcag tggtggtggt ggtggtgctc gagtgcggcc gcaagcttgt
      181 cgacggagct cgaattcgga tccgatatca gccatggaac cgcgtggcac cagggtaccc
      241 agatctgggc tgtccatgtg ctggcgttcg aatttagcag cagcggtttc tttcatatgt
      301 atatctcctt cttaaagtta aacaaaatta tttctagagg ggaattgtta tccgctcaca
      361 attcccctat agtgagtcgt attaatttcg cgggatcgag atcgatctcg atcctctacg
      421 ccggacgcat cgtggccggc atcaccggcg ccacaggtgc ggttgctggc gcctatatcg
      481 ccgacatcac cgatggggaa gatcgggctc gccacttcgg gctcatgagc gcttgtttcg
      541 gcgtgggtat ggtggcaggc cccgtggccg ggggactgtt gggcgccatc tccttgcatg
      601 caccattcct tgcggcggcg gtgctcaacg gcctcaacct actactgggc tgcttcctaa
      661 tgcaggagtc gcataaggga gagcgtcgag atcccggaca ccatcgaatg gcgcaaaacc
      721 tttcgcggta tggcatgata gcgcccggaa gagagtcaat tcagggtggt gaatgtgaaa
      781 ccagtaacgt tatacgatgt cgcagagtat gccggtgtct cttatcagac cgtttcccgc
      841 gtggtgaacc aggccagcca cgtttctgcg aaaacgcggg aaaaagtgga agcggcgatg
      901 gcggagctga attacattcc caaccgcgtg gcacaacaac tggcgggcaa acagtcgttg
      961 ctgattggcg ttgccacctc cagtctggcc ctgcacgcgc cgtcgcaaat tgtcgcggcg
     1021 attaaatctc gcgccgatca actgggtgcc agcgtggtgg tgtcgatggt agaacgaagc
     1081 ggcgtcgaag cctgtaaagc ggcggtgcac aatcttctcg cgcaacgcgt cagtgggctg
     1141 atcattaact atccgctgga tgaccaggat gccattgctg tggaagctgc ctgcactaat
     1201 gttccggcgt tatttcttga tgtctctgac cagacaccca tcaacagtat tattttctcc
     1261 catgaagacg gtacgcgact gggcgtggag catctggtcg cattgggtca ccagcaaatc
     1321 gcgctgttag cgggcccatt aagttctgtc tcggcgcgtc tgcgtctggc tggctggcat
     1381 aaatatctca ctcgcaatca aattcagccg atagcggaac gggaaggcga ctggagtgcc
     1441 atgtccggtt ttcaacaaac catgcaaatg ctgaatgagg gcatcgttcc cactgcgatg
     1501 ctggttgcca acgatcagat ggcgctgggc gcaatgcgcg ccattaccga gtccgggctg
     1561 cgcgttggtg cggacatctc ggtagtggga tacgacgata ccgaagacag ctcatgttat
     1621 atcccgccgt taaccaccat caaacaggat tttcgcctgc tggggcaaac cagcgtggac
     1681 cgcttgctgc aactctctca gggccaggcg gtgaagggca atcagctgtt gcccgtctca
     1741 ctggtgaaaa gaaaaaccac cctggcgccc aatacgcaaa ccgcctctcc ccgcgcgttg
     1801 gccgattcat taatgcagct ggcacgacag gtttcccgac tggaaagcgg gcagtgagcg
     1861 caacgcaatt aatgtaagtt agctcactca ttaggcaccg ggatctcgac cgatgccctt
     1921 gagagccttc aacccagtca gctccttccg gtgggcgcgg ggcatgacta tcgtcgccgc
     1981 acttatgact gtcttcttta tcatgcaact cgtaggacag gtgccggcag cgctctgggt
     2041 cattttcggc gaggaccgct ttcgctggag cgcgacgatg atcggcctgt cgcttgcggt
     2101 attcggaatc ttgcacgccc tcgctcaagc cttcgtcact ggtcccgcca ccaaacgttt
     2161 cggcgagaag caggccatta tcgccggcat ggcggcccca cgggtgcgca tgatcgtgct
     2221 cctgtcgttg aggacccggc taggctggcg gggttgcctt actggttagc agaatgaatc
     2281 accgatacgc gagcgaacgt gaagcgactg ctgctgcaaa acgtctgcga cctgagcaac
     2341 aacatgaatg gtcttcggtt tccgtgtttc gtaaagtctg gaaacgcgga agtcagcgcc
     2401 ctgcaccatt atgttccgga tctgcatcgc aggatgctgc tggctaccct gtggaacacc
     2461 tacatctgta ttaacgaagc gctggcattg accctgagtg atttttctct ggtcccgccg
     2521 catccatacc gccagttgtt taccctcaca acgttccagt aaccgggcat gttcatcatc
     2581 agtaacccgt atcgtgagca tcctctctcg tttcatcggt atcattaccc ccatgaacag
     2641 aaatccccct tacacggagg catcagtgac caaacaggaa aaaaccgccc ttaacatggc
     2701 ccgctttatc agaagccaga cattaacgct tctggagaaa ctcaacgagc tggacgcgga
     2761 tgaacaggca gacatctgtg aatcgcttca cgaccacgct gatgagcttt accgcagctg
     2821 cctcgcgcgt ttcggtgatg acggtgaaaa cctctgacac atgcagctcc cggagacggt
     2881 cacagcttgt ctgtaagcgg atgccgggag cagacaagcc cgtcagggcg cgtcagcggg
     2941 tgttggcggg tgtcggggcg cagccatgac ccagtcacgt agcgatagcg gagtgtatac
     3001 tggcttaact atgcggcatc agagcagatt gtactgagag tgcaccatat atgcggtgtg
     3061 aaataccgca cagatgcgta aggagaaaat accgcatcag gcgctcttcc gcttcctcgc
     3121 tcactgactc gctgcgctcg gtcgttcggc tgcggcgagc ggtatcagct cactcaaagg
     3181 cggtaatacg gttatccaca gaatcagggg ataacgcagg aaagaacatg tgagcaaaag
     3241 gccagcaaaa ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc
     3301 gcccccctga cgagcatcac aaaaatcgac gctcaagtca gaggtggcga aacccgacag
     3361 gactataaag ataccaggcg tttccccctg gaagctccct cgtgcgctct cctgttccga
     3421 ccctgccgct taccggatac ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc
     3481 atagctcacg ctgtaggtat ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg
     3541 tgcacgaacc ccccgttcag cccgaccgct gcgccttatc cggtaactat cgtcttgagt
     3601 ccaacccggt aagacacgac ttatcgccac tggcagcagc cactggtaac aggattagca
     3661 gagcgaggta tgtaggcggt gctacagagt tcttgaagtg gtggcctaac tacggctaca
     3721 ctagaaggac agtatttggt atctgcgctc tgctgaagcc agttaccttc ggaaaaagag
     3781 ttggtagctc ttgatccggc aaacaaacca ccgctggtag cggtggtttt tttgtttgca
     3841 agcagcagat tacgcgcaga aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg
     3901 ggtctgacgc tcagtggaac gaaaactcac gttaagggat tttggtcatg aacaataaaa
     3961 ctgtctgctt acataaacag taatacaagg ggtgttatga gccatattca acgggaaacg
     4021 tcttgctcta ggccgcgatt aaattccaac atggatgctg atttatatgg gtataaatgg
     4081 gctcgcgata atgtcgggca atcaggtgcg acaatctatc gattgtatgg gaagcccgat
     4141 gcgccagagt tgtttctgaa acatggcaaa ggtagcgttg ccaatgatgt tacagatgag
     4201 atggtcagac taaactggct gacggaattt atgcctcttc cgaccatcaa gcattttatc
     4261 cgtactcctg atgatgcatg gttactcacc actgcgatcc ccgggaaaac agcattccag
     4321 gtattagaag aatatcctga ttcaggtgaa aatattgttg atgcgctggc agtgttcctg
     4381 cgccggttgc attcgattcc tgtttgtaat tgtcctttta acagcgatcg cgtatttcgt
     4441 ctcgctcagg cgcaatcacg aatgaataac ggtttggttg atgcgagtga ttttgatgac
     4501 gagcgtaatg gctggcctgt tgaacaagtc tggaaagaaa tgcataaact tttgccattc
     4561 tcaccggatt cagtcgtcac tcatggtgat ttctcacttg ataaccttat ttttgacgag
     4621 gggaaattaa taggttgtat tgatgttgga cgagtcggaa tcgcagaccg ataccaggat
     4681 cttgccatcc tatggaactg cctcggtgag ttttctcctt cattacagaa acggcttttt
     4741 caaaaatatg gtattgataa tcctgatatg aataaattgc agtttcattt gatgctcgat
     4801 gagtttttct aagaattaat tcatgagcgg atacatattt gaatgtattt agaaaaataa
     4861 acaaataggg gttccgcgca catttccccg aaaagtgcca cctgaaattg taaacgttaa
     4921 tattttgtta aaattcgcgt taaatttttg ttaaatcagc tcatttttta accaataggc
     4981 cgaaatcggc aaaatccctt ataaatcaaa agaatagacc gagatagggt tgagtgttgt
     5041 tccagtttgg aacaagagtc cactattaaa gaacgtggac tccaacgtca aagggcgaaa
     5101 aaccgtctat cagggcgatg gcccactacg tgaaccatca ccctaatcaa gttttttggg
     5161 gtcgaggtgc cgtaaagcac taaatcggaa ccctaaaggg agcccccgat ttagagcttg
     5221 acggggaaag ccggcgaacg tggcgagaaa ggaagggaag aaagcgaaag gagcgggcgc
     5281 tagggcgctg gcaagtgtag cggtcacgct gcgcgtaacc accacacccg ccgcgcttaa
     5341 tgcgccgcta cagggcgcgt cccattcgcc a


No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
