pET- 30b


  • Model: PVT0085
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT0085       2ug


pET-30b Information

Promoter: T7/lac

Replicon: ColE1 ori, F1 ori

Terminator: T7 Terminator

Plasmid classification: Escherichia coli vector; PET series expression plasmid

Plasmid size: 5421bp

Plasmid tagging: N-6 * His, N-S, N-Thrombin, N-EK, C-6 * H

Prokaryotic resistance: kanamycin Kan

Clonal strain: DH5 alpha

Culture conditions: 37 C, aerobic, LB

Expression host: BL21 (DE3)

Culture conditions: 37 C, aerobic, LB

Induction: IPTG or lactose and its analogues.

5'sequencing primers: T7:TAATACGACTCACTATAGGG

3'sequencing primers: T7-ter:TGCTAGTTATTGCTCAGCGG


pET-30b Description

pET-30a-c(+) vectors carry an N-terminal His• Tag®/ thrombin/ S• Tag™/ enterokinase configuration plus an optional C-terminal His• Tag sequence. Unique sites are shown on the circle map. Note that the sequence is numbered by the pBR322 convention, so the T7 expression region is reversed on the circular map. The cloning/expression region of the coding strand transcribed by T7 RNA polymerase is shown below. The f1 origin is oriented so that infection with helper phage will produce virions containing single-stranded DNA that corresponds to the coding strand. Therefore, single-stranded sequencing should be performed using the T7 terminator primer .


pET-30b Multiple cloning site



pET-30b Sequence

LOCUS       Exported                5421 bp ds-DNA     circular SYN 05-8-2015
DEFINITION  synthetic circular DNA
KEYWORDS    Untitled 4
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 5421)
  TITLE     Direct Submission
  JOURNAL   Exported 2015-8-5 
FEATURES             Location/Qualifiers
     source          1..5421
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     source          354..376
                     /organism="Enterobacteria phage T7"
                     /mol_type="genomic DNA"
     terminator      26..73
                     /note="T7 terminator"
                     /note="transcription terminator for bacteriophage T7 RNA
     CDS             complement(140..157)
                     /product="6xHis affinity tag"
     CDS             complement(218..232)
                     /product="enterokinase recognition and cleavage site"
                     /note="enterokinase site"
     CDS             complement(248..292)
                     /product="affinity and epitope tag derived from pancreatic
                     ribonuclease A"
     CDS             complement(299..316)
                     /product="thrombin recognition and cleavage site"
                     /note="thrombin site"
     CDS             complement(326..343)
                     /product="6xHis affinity tag"
     RBS             354..376
                     /note="efficient ribosome binding site from bacteriophage
                     T7 gene 10 (Olins and Rangwala, 1989)"
     protein_bind    391..415
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(416..434)
                     /note="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     promoter        747..824
                     /note="lacI promoter"
     CDS             825..1907
                     /product="lac repressor"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     CDS             2716..2907
                     /product="Rop protein, which maintains plasmids at low copy
     misc_feature    3009..3151
                     /note="basis of mobility region from pBR322"
     rep_origin      complement(3337..3925)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     CDS             4047..4862
                     /product="aminoglycoside phosphotransferase"
                     /note="confers resistance to kanamycin in bacteria or G418
                     (Geneticin(R)) in eukaryotes"
     rep_origin      complement(4955..5410)
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
        1 atccggatat agttcctcct ttcagcaaaa aacccctcaa gacccgttta gaggccccaa
       61 ggggttatgc tagttattgc tcagcggtgg cagcagccaa ctcagcttcc tttcgggctt
      121 tgttagcagc cggatctcag tggtggtggt ggtggtgctc gagtgcggcc gcaagcttgt
      181 cgacggagct cgaattcgga tccgatatcg ccatggcctt gtcgtcgtcg tcggtaccca
      241 gatctgggct gtccatgtgc tggcgttcga atttagcagc agcggtttct ttcataccag
      301 aaccgcgtgg caccagacca gaagaatgat gatgatgatg gtgcatatgt atatctcctt
      361 cttaaagtta aacaaaatta tttctagagg ggaattgtta tccgctcaca attcccctat
      421 agtgagtcgt attaatttcg cgggatcgag atcgatctcg atcctctacg ccggacgcat
      481 cgtggccggc atcaccggcg ccacaggtgc ggttgctggc gcctatatcg ccgacatcac
      541 cgatggggaa gatcgggctc gccacttcgg gctcatgagc gcttgtttcg gcgtgggtat
      601 ggtggcaggc cccgtggccg ggggactgtt gggcgccatc tccttgcatg caccattcct
      661 tgcggcggcg gtgctcaacg gcctcaacct actactgggc tgcttcctaa tgcaggagtc
      721 gcataaggga gagcgtcgag atcccggaca ccatcgaatg gcgcaaaacc tttcgcggta
      781 tggcatgata gcgcccggaa gagagtcaat tcagggtggt gaatgtgaaa ccagtaacgt
      841 tatacgatgt cgcagagtat gccggtgtct cttatcagac cgtttcccgc gtggtgaacc
      901 aggccagcca cgtttctgcg aaaacgcggg aaaaagtgga agcggcgatg gcggagctga
      961 attacattcc caaccgcgtg gcacaacaac tggcgggcaa acagtcgttg ctgattggcg
     1021 ttgccacctc cagtctggcc ctgcacgcgc cgtcgcaaat tgtcgcggcg attaaatctc
     1081 gcgccgatca actgggtgcc agcgtggtgg tgtcgatggt agaacgaagc ggcgtcgaag
     1141 cctgtaaagc ggcggtgcac aatcttctcg cgcaacgcgt cagtgggctg atcattaact
     1201 atccgctgga tgaccaggat gccattgctg tggaagctgc ctgcactaat gttccggcgt
     1261 tatttcttga tgtctctgac cagacaccca tcaacagtat tattttctcc catgaagacg
     1321 gtacgcgact gggcgtggag catctggtcg cattgggtca ccagcaaatc gcgctgttag
     1381 cgggcccatt aagttctgtc tcggcgcgtc tgcgtctggc tggctggcat aaatatctca
     1441 ctcgcaatca aattcagccg atagcggaac gggaaggcga ctggagtgcc atgtccggtt
     1501 ttcaacaaac catgcaaatg ctgaatgagg gcatcgttcc cactgcgatg ctggttgcca
     1561 acgatcagat ggcgctgggc gcaatgcgcg ccattaccga gtccgggctg cgcgttggtg
     1621 cggacatctc ggtagtggga tacgacgata ccgaagacag ctcatgttat atcccgccgt
     1681 taaccaccat caaacaggat tttcgcctgc tggggcaaac cagcgtggac cgcttgctgc
     1741 aactctctca gggccaggcg gtgaagggca atcagctgtt gcccgtctca ctggtgaaaa
     1801 gaaaaaccac cctggcgccc aatacgcaaa ccgcctctcc ccgcgcgttg gccgattcat
     1861 taatgcagct ggcacgacag gtttcccgac tggaaagcgg gcagtgagcg caacgcaatt
     1921 aatgtaagtt agctcactca ttaggcaccg ggatctcgac cgatgccctt gagagccttc
     1981 aacccagtca gctccttccg gtgggcgcgg ggcatgacta tcgtcgccgc acttatgact
     2041 gtcttcttta tcatgcaact cgtaggacag gtgccggcag cgctctgggt cattttcggc
     2101 gaggaccgct ttcgctggag cgcgacgatg atcggcctgt cgcttgcggt attcggaatc
     2161 ttgcacgccc tcgctcaagc cttcgtcact ggtcccgcca ccaaacgttt cggcgagaag
     2221 caggccatta tcgccggcat ggcggcccca cgggtgcgca tgatcgtgct cctgtcgttg
     2281 aggacccggc taggctggcg gggttgcctt actggttagc agaatgaatc accgatacgc
     2341 gagcgaacgt gaagcgactg ctgctgcaaa acgtctgcga cctgagcaac aacatgaatg
     2401 gtcttcggtt tccgtgtttc gtaaagtctg gaaacgcgga agtcagcgcc ctgcaccatt
     2461 atgttccgga tctgcatcgc aggatgctgc tggctaccct gtggaacacc tacatctgta
     2521 ttaacgaagc gctggcattg accctgagtg atttttctct ggtcccgccg catccatacc
     2581 gccagttgtt taccctcaca acgttccagt aaccgggcat gttcatcatc agtaacccgt
     2641 atcgtgagca tcctctctcg tttcatcggt atcattaccc ccatgaacag aaatccccct
     2701 tacacggagg catcagtgac caaacaggaa aaaaccgccc ttaacatggc ccgctttatc
     2761 agaagccaga cattaacgct tctggagaaa ctcaacgagc tggacgcgga tgaacaggca
     2821 gacatctgtg aatcgcttca cgaccacgct gatgagcttt accgcagctg cctcgcgcgt
     2881 ttcggtgatg acggtgaaaa cctctgacac atgcagctcc cggagacggt cacagcttgt
     2941 ctgtaagcgg atgccgggag cagacaagcc cgtcagggcg cgtcagcggg tgttggcggg
     3001 tgtcggggcg cagccatgac ccagtcacgt agcgatagcg gagtgtatac tggcttaact
     3061 atgcggcatc agagcagatt gtactgagag tgcaccatat atgcggtgtg aaataccgca
     3121 cagatgcgta aggagaaaat accgcatcag gcgctcttcc gcttcctcgc tcactgactc
     3181 gctgcgctcg gtcgttcggc tgcggcgagc ggtatcagct cactcaaagg cggtaatacg
     3241 gttatccaca gaatcagggg ataacgcagg aaagaacatg tgagcaaaag gccagcaaaa
     3301 ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc gcccccctga
     3361 cgagcatcac aaaaatcgac gctcaagtca gaggtggcga aacccgacag gactataaag
     3421 ataccaggcg tttccccctg gaagctccct cgtgcgctct cctgttccga ccctgccgct
     3481 taccggatac ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc atagctcacg
     3541 ctgtaggtat ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc
     3601 ccccgttcag cccgaccgct gcgccttatc cggtaactat cgtcttgagt ccaacccggt
     3661 aagacacgac ttatcgccac tggcagcagc cactggtaac aggattagca gagcgaggta
     3721 tgtaggcggt gctacagagt tcttgaagtg gtggcctaac tacggctaca ctagaaggac
     3781 agtatttggt atctgcgctc tgctgaagcc agttaccttc ggaaaaagag ttggtagctc
     3841 ttgatccggc aaacaaacca ccgctggtag cggtggtttt tttgtttgca agcagcagat
     3901 tacgcgcaga aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg ggtctgacgc
     3961 tcagtggaac gaaaactcac gttaagggat tttggtcatg aacaataaaa ctgtctgctt
     4021 acataaacag taatacaagg ggtgttatga gccatattca acgggaaacg tcttgctcta
     4081 ggccgcgatt aaattccaac atggatgctg atttatatgg gtataaatgg gctcgcgata
     4141 atgtcgggca atcaggtgcg acaatctatc gattgtatgg gaagcccgat gcgccagagt
     4201 tgtttctgaa acatggcaaa ggtagcgttg ccaatgatgt tacagatgag atggtcagac
     4261 taaactggct gacggaattt atgcctcttc cgaccatcaa gcattttatc cgtactcctg
     4321 atgatgcatg gttactcacc actgcgatcc ccgggaaaac agcattccag gtattagaag
     4381 aatatcctga ttcaggtgaa aatattgttg atgcgctggc agtgttcctg cgccggttgc
     4441 attcgattcc tgtttgtaat tgtcctttta acagcgatcg cgtatttcgt ctcgctcagg
     4501 cgcaatcacg aatgaataac ggtttggttg atgcgagtga ttttgatgac gagcgtaatg
     4561 gctggcctgt tgaacaagtc tggaaagaaa tgcataaact tttgccattc tcaccggatt
     4621 cagtcgtcac tcatggtgat ttctcacttg ataaccttat ttttgacgag gggaaattaa
     4681 taggttgtat tgatgttgga cgagtcggaa tcgcagaccg ataccaggat cttgccatcc
     4741 tatggaactg cctcggtgag ttttctcctt cattacagaa acggcttttt caaaaatatg
     4801 gtattgataa tcctgatatg aataaattgc agtttcattt gatgctcgat gagtttttct
     4861 aagaattaat tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg
     4921 gttccgcgca catttccccg aaaagtgcca cctgaaattg taaacgttaa tattttgtta
     4981 aaattcgcgt taaatttttg ttaaatcagc tcatttttta accaataggc cgaaatcggc
     5041 aaaatccctt ataaatcaaa agaatagacc gagatagggt tgagtgttgt tccagtttgg
     5101 aacaagagtc cactattaaa gaacgtggac tccaacgtca aagggcgaaa aaccgtctat
     5161 cagggcgatg gcccactacg tgaaccatca ccctaatcaa gttttttggg gtcgaggtgc
     5221 cgtaaagcac taaatcggaa ccctaaaggg agcccccgat ttagagcttg acggggaaag
     5281 ccggcgaacg tggcgagaaa ggaagggaag aaagcgaaag gagcgggcgc tagggcgctg
     5341 gcaagtgtag cggtcacgct gcgcgtaacc accacacccg ccgcgcttaa tgcgccgcta
     5401 cagggcgcgt cccattcgcc a


Search name

pET-30b,Plasmid pET-30b,pET-30b vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
