pET- 31b


  • Model: PVT0088
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT0088   2ug


pET-31b Information

Replicon: ColE1 ori, F1 ori

Terminator: T7 Terminator

Plasmid classification: large intestine plasmid; large intestine expression plasmid; pET series plasmid.

Plasmid size: 5742bp

Plasmid tagging: C-6 * His

Prokaryotic resistance: ampicillin Amp (100 g/ml)

Cloning strains: E. coli DH5 and E.

Culture conditions: 37 C, aerobic, LB

Expression host: E. coli BL21 (DE3).

Culture conditions: 37 C, aerobic, LB

Induction: IPTG or lactose and its analogues.

5'sequencing primers: T7 (TAATACGACTCACTATAGGG)

3'sequencing primers: T7-ter (TGCTAGTTATTGCTCAGCGG)

Remarks: ketosterol isomerase expression


pET-31b Description

pET-31b is a prokaryotic expression vector with a 6*His tag at the C-terminal. The target gene was cloned into the plasmid vector and controlled by phage strong transcription and translation signals.

The pET system is the most powerful system ever used to express recombinant protein in E. coli. It is also the most widely used system in prokaryotic expression. The plasmids can easily reduce protein expression by decreasing the concentration of inducers. Under non inducible conditions, the target gene can be completely silenced without transcribing.

The pET-31b(+) vector is designed for cloning and high-level expression of peptide sequences fused with the 125aa ketosteroid isomerase protein (1). The unique AlwN I cloning site allows the unidirectional insertion of of tandemly repeated peptide coding regions separated by methionine codons. Unique sites are shown on the circle map. Note that the sequence is numbered by the pBR322 convention, so the T7 expression region is reversed on the circular map. The cloning/expression region of the coding strand transcribed by T7 RNA polymerase is shown below. The f1 origin is oriented so that infection with helper phage will produce virions containing single-stranded DNA that corresponds to the coding strand. Therefore, single-stranded sequencing should be performed using the T7 terminator primer .


pET-31b Multiple cloning site




pET-31b Sequence

LOCUS       Exported                5742 bp ds-DNA     circular SYN 05-8-2015
DEFINITION  synthetic circular DNA
KEYWORDS    Untitled 7
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 5742)
  TITLE     Direct Submission
  JOURNAL   Exported 2015-8-5 
FEATURES             Location/Qualifiers
     source          1..5742
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     source          552..574
                     /organism="Enterobacteria phage T7"
                     /mol_type="genomic DNA"
     terminator      26..73
                     /note="T7 terminator"
                     /note="transcription terminator for bacteriophage T7 RNA
     CDS             complement(140..157)
                     /product="6xHis affinity tag"
     CDS             complement(170..544)
                     /product="ketosteroid isomerase"
     RBS             552..574
                     /note="efficient ribosome binding site from bacteriophage
                     T7 gene 10 (Olins and Rangwala, 1989)"
     protein_bind    589..613
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(614..632)
                     /note="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     promoter        941..1018
                     /note="lacI promoter"
     CDS             1019..2101
                     /product="lac repressor"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     CDS             2910..3101
                     /product="Rop protein, which maintains plasmids at low copy
     misc_feature    3203..3345
                     /note="basis of mobility region from pBR322"
     CDS             complement(4284..5144)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     promoter        complement(5145..5249)
                     /note="AmpR promoter"
     rep_origin      complement(5276..5731)
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
        1 atccggatat agttcctcct ttcagcaaaa aacccctcaa gacccgttta gaggccccaa
       61 ggggttatgc tagttattgc tcagcggtgg cagcagccaa ctcagcttcc tttcgggctt
      121 tgttagcagc cggatctcag tggtggtggt ggtggtgctc gagcagcatc tggcatgcgt
      181 gaatattctt ctcgccaaac aaggcgcgga tgctcaccac cttgccggcg ccattgaagc
      241 gaaagtgatc gatgggcgca actacggtct tgcggccctg atactcgaag ctgacggtga
      301 aagcgaaggc cgcttcgttg gcgaccgcgc gtacctcctg cgtcagctcc accgccaaag
      361 gcagtttgag cgagttggcg taaaactcac gaatcgcagc cgtaccggac ctgggctcgg
      421 aacccacggg gtcttccacc gtggcgtcat cggcaaacag cgcgacgatg ccgtccagat
      481 cgccggcatt gagcgcagcc acaaagcgct gtaccacggc ggtgatgtgt tctggggtat
      541 gcatatgtat atctccttct taaagttaaa caaaattatt tctagagggg aattgttatc
      601 cgctcacaat tcccctatag tgagtcgtat taatttcgcg ggatcgagat ctcgatcctc
      661 tacgccggac gcatcgtggc cggcatcacc ggcgccacag gtgcggttgc tggcgcctat
      721 atcgccgaca tcaccgatgg ggaagatcgg gctcgccact tcgggctcat gagcgcttgt
      781 ttcggcgtgg gtatggtggc aggccccgtg gccgggggac tgttgggcgc catctccttg
      841 catgcaccat tccttgcggc ggcggtgctc aacggcctca acctactact gggctgcttc
      901 ctaatgcagg agtcgcataa gggagagcgt cgagatcccg gacaccatcg aatggcgcaa
      961 aacctttcgc ggtatggcat gatagcgccc ggaagagagt caattcaggg tggtgaatgt
     1021 gaaaccagta acgttatacg atgtcgcaga gtatgccggt gtctcttatc agaccgtttc
     1081 ccgcgtggtg aaccaggcca gccacgtttc tgcgaaaacg cgggaaaaag tggaagcggc
     1141 gatggcggag ctgaattaca ttcccaaccg cgtggcacaa caactggcgg gcaaacagtc
     1201 gttgctgatt ggcgttgcca cctccagtct ggccctgcac gcgccgtcgc aaattgtcgc
     1261 ggcgattaaa tctcgcgccg atcaactggg tgccagcgtg gtggtgtcga tggtagaacg
     1321 aagcggcgtc gaagcctgta aagcggcggt gcacaatctt ctcgcgcaac gcgtcagtgg
     1381 gctgatcatt aactatccgc tggatgacca ggatgccatt gctgtggaag ctgcctgcac
     1441 taatgttccg gcgttatttc ttgatgtctc tgaccagaca cccatcaaca gtattatttt
     1501 ctcccatgaa gacggtacgc gactgggcgt ggagcatctg gtcgcattgg gtcaccagca
     1561 aatcgcgctg ttagcgggcc cattaagttc tgtctcggcg cgtctgcgtc tggctggctg
     1621 gcataaatat ctcactcgca atcaaattca gccgatagcg gaacgggaag gcgactggag
     1681 tgccatgtcc ggttttcaac aaaccatgca aatgctgaat gagggcatcg ttcccactgc
     1741 gatgctggtt gccaacgatc agatggcgct gggcgcaatg cgcgccatta ccgagtccgg
     1801 gctgcgcgtt ggtgcggata tctcggtagt gggatacgac gataccgaag acagctcatg
     1861 ttatatcccg ccgttaacca ccatcaaaca ggattttcgc ctgctggggc aaaccagcgt
     1921 ggaccgcttg ctgcaactct ctcagggcca ggcggtgaag ggcaatcagc tgttgcccgt
     1981 ctcactggtg aaaagaaaaa ccaccctggc gcccaatacg caaaccgcct ctccccgcgc
     2041 gttggccgat tcattaatgc agctggcacg acaggtttcc cgactggaaa gcgggcagtg
     2101 agcgcaacgc aattaatgta agttagctca ctcattaggc accgggatct cgaccgatgc
     2161 ccttgagagc cttcaaccca gtcagctcct tccggtgggc gcggggcatg actatcgtcg
     2221 ccgcacttat gactgtcttc tttatcatgc aactcgtagg acaggtgccg gcagcgctct
     2281 gggtcatttt cggcgaggac cgctttcgct ggagcgcgac gatgatcggc ctgtcgcttg
     2341 cggtattcgg aatcttgcac gccctcgctc aagccttcgt cactggtccc gccaccaaac
     2401 gtttcggcga gaagcaggcc attatcgccg gcatggcggc cccacgggtg cgcatgatcg
     2461 tgctcctgtc gttgaggacc cggctaggct ggcggggttg ccttactggt tagcagaatg
     2521 aatcaccgat acgcgagcga acgtgaagcg actgctgctg caaaacgtct gcgacctgag
     2581 caacaacatg aatggtcttc ggtttccgtg tttcgtaaag tctggaaacg cggaagtcag
     2641 cgccctgcac cattatgttc cggatctgca tcgcaggatg ctgctggcta ccctgtggaa
     2701 cacctacatc tgtattaacg aagcgctggc attgaccctg agtgattttt ctctggtccc
     2761 gccgcatcca taccgccagt tgtttaccct cacaacgttc cagtaaccgg gcatgttcat
     2821 catcagtaac ccgtatcgtg agcatcctct ctcgtttcat cggtatcatt acccccatga
     2881 acagaaatcc cccttacacg gaggcatcag tgaccaaaca ggaaaaaacc gcccttaaca
     2941 tggcccgctt tatcagaagc cagacattaa cgcttctgga gaaactcaac gagctggacg
     3001 cggatgaaca ggcagacatc tgtgaatcgc ttcacgacca cgctgatgag ctttaccgca
     3061 gctgcctcgc gcgtttcggt gatgacggtg aaaacctctg acacatgcag ctcccggaga
     3121 cggtcacagc ttgtctgtaa gcggatgccg ggagcagaca agcccgtcag ggcgcgtcag
     3181 cgggtgttgg cgggtgtcgg ggcgcagcca tgacccagtc acgtagcgat agcggagtgt
     3241 atactggctt aactatgcgg catcagagca gattgtactg agagtgcacc atatatgcgg
     3301 tgtgaaatac cgcacagatg cgtaaggaga aaataccgca tcaggcgctc ttccgcttcc
     3361 tcgctcactg actcgctgcg ctcggtcgtt cggctgcggc gagcggtatc agctcactca
     3421 aaggcggtaa tacggttatc cacagaatca ggggataacg caggaaagaa catgtgagca
     3481 aaaggccagc aaaaggccag gaaccgtaaa aaggccgcgt tgctggcgtt tttccatagg
     3541 ctccgccccc ctgacgagca tcacaaaaat cgacgctcaa gtcagaggtg gcgaaacccg
     3601 acaggactat aaagatacca ggcgtttccc cctggaagct ccctcgtgcg ctctcctgtt
     3661 ccgaccctgc cgcttaccgg atacctgtcc gcctttctcc cttcgggaag cgtggcgctt
     3721 tctcatagct cacgctgtag gtatctcagt tcggtgtagg tcgttcgctc caagctgggc
     3781 tgtgtgcacg aaccccccgt tcagcccgac cgctgcgcct tatccggtaa ctatcgtctt
     3841 gagtccaacc cggtaagaca cgacttatcg ccactggcag ctggtaacag gattagcaga
     3901 gcgaggtatg taggcggtgc tacagagttc ttgaagtggt ggcctaacta cggctacact
     3961 agaaggacag tatttggtat ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt
     4021 ggtagctctt gatccggcaa acaaaccacc gctggtagcg gtggtttttt tgtttgcaag
     4081 cagcagatta cgcgcagaaa aaaaggatct caagaagatc ctttgatctt ttctacgggg
     4141 tctgacgctc agtggaacga aaactcacgt taagggattt tggtcatgag attatcaaaa
     4201 aggatcttca cctagatcct tttaaattaa aaatgaagtt ttaaatcaat ctaaagtata
     4261 tatgagtaaa cttggtctga cagttaccaa tgcttaatca gtgaggcacc tatctcagcg
     4321 atctgtctat ttcgttcatc catagttgcc tgactccccg tcgtgtagat aactacgata
     4381 cgggagggct taccatctgg ccccagtgct gcaatgatac cgcgagaccc acgctcaccg
     4441 gctccagatt tatcagcaat aaaccagcca gccggaaggg ccgagcgcag aagtggtcct
     4501 gcaactttat ccgcctccat ccagtctatt aattgttgcc gggaagctag agtaagtagt
     4561 tcgccagtta atagtttgcg caacgttgtt gccattgctg caggcatcgt ggtgtcacgc
     4621 tcgtcgtttg gtatggcttc attcagctcc ggttcccaac gatcaaggcg agttacatga
     4681 tcccccatgt tgtgcaaaaa agcggttagc tccttcggtc ctccgatcgt tgtcagaagt
     4741 aagttggccg cagtgttatc actcatggtt atggcagcac tgcataattc tcttactgtc
     4801 atgccatccg taagatgctt ttctgtgact ggtgagtact caaccaagtc attctgagaa
     4861 tagtgtatgc ggcgaccgag ttgctcttgc ccggcgtcaa tacgggataa taccgcgcca
     4921 catagcagaa ctttaaaagt gctcatcatt ggaaaacgtt cttcggggcg aaaactctca
     4981 aggatcttac cgctgttgag atccagttcg atgtaaccca ctcgtgcacc caactgatct
     5041 tcagcatctt ttactttcac cagcgtttct gggtgagcaa aaacaggaag gcaaaatgcc
     5101 gcaaaaaagg gaataagggc gacacggaaa tgttgaatac tcatactctt cctttttcaa
     5161 tattattgaa gcatttatca gggttattgt ctcatgagcg gatacatatt tgaatgtatt
     5221 tagaaaaata aacaaatagg ggttccgcgc acatttcccc gaaaagtgcc acctgaaatt
     5281 gtaaacgtta atattttgtt aaaattcgcg ttaaattttt gttaaatcag ctcatttttt
     5341 aaccaatagg ccgaaatcgg caaaatccct tataaatcaa aagaatagac cgagataggg
     5401 ttgagtgttg ttccagtttg gaacaagagt ccactattaa agaacgtgga ctccaacgtc
     5461 aaagggcgaa aaaccgtcta tcagggcgat ggcccactac gtgaaccatc accctaatca
     5521 agttttttgg ggtcgaggtg ccgtaaagca ctaaatcgga accctaaagg gagcccccga
     5581 tttagagctt gacggggaaa gccggcgaac gtggcgagaa aggaagggaa gaaagcgaaa
     5641 ggagcgggcg ctagggcgct ggcaagtgta gcggtcacgc tgcgcgtaac caccacaccc
     5701 gccgcgctta atgcgccgct acagggcgcg tcccattcgc ca


Product is for research use only!


Search name

pET-31b,Plasmid pET-31b,pET-31b vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
