pET- 32c


  • Model: PVT0091
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pET-32c,Plasmid pET-32c,pET-32c vector

pET-32c information

Promoter: T7/laco promoter
Replicator: ColE1 ori, F1 ori
Terminator: T7 Terminator
Plasmid classification: Escherichia coli vector; PET series expression plasmid
Plasmid size: 5901bp
Plasmid Tags: N-Trx, N-6 x His, N-thrombin, N-S, N-enterokinase, C-6 x His
Prokaryotic resistance: ampicillin Amp
Cloned strain: Escherichia coli DH5 alpha
Culture conditions: 37 centigrade, aerobic, LB
Expression host: Escherichia coli BL21 (DE3)
Culture conditions: 37 centigrade, aerobic, LB
Inducement: IPTG or lactose and its analogues
5'sequencing primers: T7:TAATACGACTCACTATAGGG
3'sequencing primers: T7-ter:TGCTAGTTATTGCTCAGCGG
Use:pET Plasmid


pET-32c description
The pET-32 series is designed for cloning and high-level expression of peptide sequences fused with the 109aa Trx•Tag thioredoxin protein . Cloning sites are available for producing fusion proteins also containing cleavable His•Tag and S•Tag sequences for detection and purification. Unique sites are shown on the circle map. Note that the sequence is numbered by the pBR322 convention, so the T7 expression region is reversed on the circle map. The cloning/expression region of the coding strand transcribed by T7 RNA polymerase is shown below. The f1 origin is oriented so that infection with helper phage will produce virions containing single-stranded DNA that corresponds to the coding strand. Therefore, single-stranded sequencing should be performed using the T7 terminator primer .

pET-32c Sequence

LOCUS       Exported                5901 bp ds-DNA     circular SYN 30-AUG-2016
DEFINITION  synthetic circular DNA
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 5901)
  TITLE     Direct Submission
FEATURES             Location/Qualifiers
     source          1..5901
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     terminator      26..73
                     /note="T7 terminator"
                     /note="transcription terminator for bacteriophage T7 RNA
     CDS             complement(140..157)
                     /product="6xHis affinity tag"
     CDS             complement(220..234)
                     /product="enterokinase recognition and cleavage site"
                     /note="enterokinase site"
     CDS             complement(250..294)
                     /product="affinity and epitope tag derived from pancreatic
                     ribonuclease A"
     CDS             complement(301..318)
                     /product="thrombin recognition and cleavage site"
                     /note="thrombin site"
     CDS             complement(328..345)
                     /product="6xHis affinity tag"
     CDS             complement(367..693)
                     /product="E. coli thioredoxin"
     protein_bind    738..762
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(763..781)
                     /note="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     promoter        1094..1171
                     /note="lacI promoter"
     CDS             1172..2254
                     /product="lac repressor"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     CDS             3063..3254
                     /product="Rop protein"
     rep_origin      complement(3684..4272)
                     /note="high-copy-number colE1/pMB1/pBR322/pUC origin of
     CDS             complement(4443..5303)

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
