pET- 37b


  • Model: PVT0094
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT0094       2ug

pET-37b Information

Promoter: T7/lac
Replicator: ColE1 ori, F1 ori
Terminator: T7 Terminator
Plasmid classification: Escherichia coli vector; PET series expression plasmid
Plasmid size: 5932bp
Plasmid Tags: N-CBD, N-thrombin, N-S, N-Factor Xa, C-8*His
Prokaryotic resistance: kanamycin Kan
Cloned strain: DH5 alpha
Culture conditions: 37 centigrade, aerobic, LB
Expression host: BL21 (DE3)
Culture conditions: 37 centigrade, aerobic, LB
Inducement: IPTG or lactose and its analogues
5'sequencing primers: T7:TAATACGACTCACTATAGGG
3'sequencing primers: T7-ter:TGCTAGTTATTGCTCAGCGG
Remarks: secretory expression, cellulose binding domain


pET-37b Description




pET-37b Sequence

LOCUS       Exported                5932 bp ds-DNA     circular SYN 10-8-2015
DEFINITION  synthetic circular DNA
KEYWORDS    Untitled
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 5932)
  TITLE     Direct Submission
  JOURNAL   Exported 2015-8-1 
FEATURES             Location/Qualifiers
     source          1..5932
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     source          865..887
                     /organism="Enterobacteria phage T7"
                     /mol_type="genomic DNA"
     terminator      26..73
                     /note="T7 terminator"
                     /note="transcription terminator for bacteriophage T7 RNA
     CDS             complement(150..173)
                     /product="8xHis affinity tag"
     CDS             complement(249..260)
                     /product="Factor Xa recognition and cleavage site"
                     /note="Factor Xa site"
     CDS             complement(291..335)
                     /product="affinity and epitope tag derived from pancreatic
                     ribonuclease A"
     CDS             complement(351..368)
                     /product="thrombin recognition and cleavage site"
                     /note="thrombin site"
     RBS             865..887
                     /note="efficient ribosome binding site from bacteriophage
                     T7 gene 10 (Olins and Rangwala, 1989)"
     protein_bind    902..926
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(927..945)
                     /note="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     promoter        1258..1335
                     /note="lacI promoter"
     CDS             1336..2418
                     /product="lac repressor"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     CDS             3227..3418
                     /product="Rop protein, which maintains plasmids at low copy
     misc_feature    3520..3662
                     /note="basis of mobility region from pBR322"
     rep_origin      complement(3848..4436)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     CDS             4558..5373
                     /product="aminoglycoside phosphotransferase"
                     /note="confers resistance to kanamycin in bacteria or G418
                     (Geneticin(R)) in eukaryotes"
     rep_origin      complement(5466..5921)
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
        1 atccggatat agttcctcct ttcagcaaaa aacccctcaa gacccgttta gaggccccaa
       61 ggggttatgc tagttattgc tcagcggtgg cagcagccaa ctcagcttcc tttcgggctt
      121 tgtttagcag cctaggtatt aatcaattag tggtggtggt ggtggtggtg gtgctcgagt
      181 gcggccgcaa gcttgtcgac ggagctcgaa ttcggatccg atatcgccat ggccagagga
      241 gagttagagc gaccctcaat accggagcca ccaccggtac ccagatctgg gctgtccatg
      301 tgctggcgtt cgaatttagc agcagcggtt tctttcatac caattgcagt actaccgcgt
      361 ggcaccagac ccgcggaacc tggtgccgtg gggctggtcg tcggcacggt gcccgtgcag
      421 gtggtgccgt tgagcgagaa cgacgccggc gtcgggttgg acccggccca cgagccgttg
      481 aacccgaacg acgccgtgcc gccggtcggg atgctgccgt tccagggcag gctggtgacg
      541 gagacctggc cgccgttggt cgaggcggtg ccgttccaca gctgctggat acgctggcct
      601 gcggtgtagg tccagtcgag cttccacgac gagacggggt cgccgaggtt ggtgatcgtg
      661 acgttggcgc cgaagccgcc gggccactgg ttggtgacgg cgtagtcgac gcggcagccg
      721 ggactagcgg cctgggcggg cagcacgacc gtggcgccga cgacgagcgt cgccgccgcg
      781 gcggcgagcg tcgtgcgcag agcggtgcgg gcgccgcggg ccgggtggcc gggtgcgggc
      841 gtggtacgag ggtccatatg tatatctcct tcttaaagtt aaacaaaatt atttctagag
      901 gggaattgtt atccgctcac aattccccta tagtgagtcg tattaatttc gcgggatcga
      961 gatcgatctc gatcctctac gccggacgca tcgtggccgg catcaccggc gccacaggtg
     1021 cggttgctgg cgcctatatc gccgacatca ccgatgggga agatcgggct cgccacttcg
     1081 ggctcatgag cgcttgtttc ggcgtgggta tggtggcagg ccccgtggcc gggggactgt
     1141 tgggcgccat ctccttgcat gcaccattcc ttgcggcggc ggtgctcaac ggcctcaacc
     1201 tactactggg ctgcttccta atgcaggagt cgcataaggg agagcgtcga gatcccggac
     1261 accatcgaat ggcgcaaaac ctttcgcggt atggcatgat agcgcccgga agagagtcaa
     1321 ttcagggtgg tgaatgtgaa accagtaacg ttatacgatg tcgcagagta tgccggtgtc
     1381 tcttatcaga ccgtttcccg cgtggtgaac caggccagcc acgtttctgc gaaaacgcgg
     1441 gaaaaagtgg aagcggcgat ggcggagctg aattacattc ccaaccgcgt ggcacaacaa
     1501 ctggcgggca aacagtcgtt gctgattggc gttgccacct ccagtctggc cctgcacgcg
     1561 ccgtcgcaaa ttgtcgcggc gattaaatct cgcgccgatc aactgggtgc cagcgtggtg
     1621 gtgtcgatgg tagaacgaag cggcgtcgaa gcctgtaaag cggcggtgca caatcttctc
     1681 gcgcaacgcg tcagtgggct gatcattaac tatccgctgg atgaccagga tgccattgct
     1741 gtggaagctg cctgcactaa tgttccggcg ttatttcttg atgtctctga ccagacaccc
     1801 atcaacagta ttattttctc ccatgaagac ggtacgcgac tgggcgtgga gcatctggtc
     1861 gcattgggtc accagcaaat cgcgctgtta gcgggcccat taagttctgt ctcggcgcgt
     1921 ctgcgtctgg ctggctggca taaatatctc actcgcaatc aaattcagcc gatagcggaa
     1981 cgggaaggcg actggagtgc catgtccggt tttcaacaaa ccatgcaaat gctgaatgag
     2041 ggcatcgttc ccactgcgat gctggttgcc aacgatcaga tggcgctggg cgcaatgcgc
     2101 gccattaccg agtccgggct gcgcgttggt gcggacatct cggtagtggg atacgacgat
     2161 accgaagaca gctcatgtta tatcccgccg ttaaccacca tcaaacagga ttttcgcctg
     2221 ctggggcaaa ccagcgtgga ccgcttgctg caactctctc agggccaggc ggtgaagggc
     2281 aatcagctgt tgcccgtctc actggtgaaa agaaaaacca ccctggcgcc caatacgcaa
     2341 accgcctctc cccgcgcgtt ggccgattca ttaatgcagc tggcacgaca ggtttcccga
     2401 ctggaaagcg ggcagtgagc gcaacgcaat taatgtaagt tagctcactc attaggcacc
     2461 gggatctcga ccgatgccct tgagagcctt caacccagtc agctccttcc ggtgggcgcg
     2521 gggcatgact atcgtcgccg cacttatgac tgtcttcttt atcatgcaac tcgtaggaca
     2581 ggtgccggca gcgctctggg tcattttcgg cgaggaccgc tttcgctgga gcgcgacgat
     2641 gatcggcctg tcgcttgcgg tattcggaat cttgcacgcc ctcgctcaag ccttcgtcac
     2701 tggtcccgcc accaaacgtt tcggcgagaa gcaggccatt atcgccggca tggcggcccc
     2761 acgggtgcgc atgatcgtgc tcctgtcgtt gaggacccgg ctaggctggc ggggttgcct
     2821 tactggttag cagaatgaat caccgatacg cgagcgaacg tgaagcgact gctgctgcaa
     2881 aacgtctgcg acctgagcaa caacatgaat ggtcttcggt ttccgtgttt cgtaaagtct
     2941 ggaaacgcgg aagtcagcgc cctgcaccat tatgttccgg atctgcatcg caggatgctg
     3001 ctggctaccc tgtggaacac ctacatctgt attaacgaag cgctggcatt gaccctgagt
     3061 gatttttctc tggtcccgcc gcatccatac cgccagttgt ttaccctcac aacgttccag
     3121 taaccgggca tgttcatcat cagtaacccg tatcgtgagc atcctctctc gtttcatcgg
     3181 tatcattacc cccatgaaca gaaatccccc ttacacggag gcatcagtga ccaaacagga
     3241 aaaaaccgcc cttaacatgg cccgctttat cagaagccag acattaacgc ttctggagaa
     3301 actcaacgag ctggacgcgg atgaacaggc agacatctgt gaatcgcttc acgaccacgc
     3361 tgatgagctt taccgcagct gcctcgcgcg tttcggtgat gacggtgaaa acctctgaca
     3421 catgcagctc ccggagacgg tcacagcttg tctgtaagcg gatgccggga gcagacaagc
     3481 ccgtcagggc gcgtcagcgg gtgttggcgg gtgtcggggc gcagccatga cccagtcacg
     3541 tagcgatagc ggagtgtata ctggcttaac tatgcggcat cagagcagat tgtactgaga
     3601 gtgcaccata tatgcggtgt gaaataccgc acagatgcgt aaggagaaaa taccgcatca
     3661 ggcgctcttc cgcttcctcg ctcactgact cgctgcgctc ggtcgttcgg ctgcggcgag
     3721 cggtatcagc tcactcaaag gcggtaatac ggttatccac agaatcaggg gataacgcag
     3781 gaaagaacat gtgagcaaaa ggccagcaaa aggccaggaa ccgtaaaaag gccgcgttgc
     3841 tggcgttttt ccataggctc cgcccccctg acgagcatca caaaaatcga cgctcaagtc
     3901 agaggtggcg aaacccgaca ggactataaa gataccaggc gtttccccct ggaagctccc
     3961 tcgtgcgctc tcctgttccg accctgccgc ttaccggata cctgtccgcc tttctccctt
     4021 cgggaagcgt ggcgctttct catagctcac gctgtaggta tctcagttcg gtgtaggtcg
     4081 ttcgctccaa gctgggctgt gtgcacgaac cccccgttca gcccgaccgc tgcgccttat
     4141 ccggtaacta tcgtcttgag tccaacccgg taagacacga cttatcgcca ctggcagcag
     4201 ccactggtaa caggattagc agagcgaggt atgtaggcgg tgctacagag ttcttgaagt
     4261 ggtggcctaa ctacggctac actagaagga cagtatttgg tatctgcgct ctgctgaagc
     4321 cagttacctt cggaaaaaga gttggtagct cttgatccgg caaacaaacc accgctggta
     4381 gcggtggttt ttttgtttgc aagcagcaga ttacgcgcag aaaaaaagga tctcaagaag
     4441 atcctttgat cttttctacg gggtctgacg ctcagtggaa cgaaaactca cgttaaggga
     4501 ttttggtcat gaacaataaa actgtctgct tacataaaca gtaatacaag gggtgttatg
     4561 agccatattc aacgggaaac gtcttgctct aggccgcgat taaattccaa catggatgct
     4621 gatttatatg ggtataaatg ggctcgcgat aatgtcgggc aatcaggtgc gacaatctat
     4681 cgattgtatg ggaagcccga tgcgccagag ttgtttctga aacatggcaa aggtagcgtt
     4741 gccaatgatg ttacagatga gatggtcaga ctaaactggc tgacggaatt tatgcctctt
     4801 ccgaccatca agcattttat ccgtactcct gatgatgcat ggttactcac cactgcgatc
     4861 cccgggaaaa cagcattcca ggtattagaa gaatatcctg attcaggtga aaatattgtt
     4921 gatgcgctgg cagtgttcct gcgccggttg cattcgattc ctgtttgtaa ttgtcctttt
     4981 aacagcgatc gcgtatttcg tctcgctcag gcgcaatcac gaatgaataa cggtttggtt
     5041 gatgcgagtg attttgatga cgagcgtaat ggctggcctg ttgaacaagt ctggaaagaa
     5101 atgcataaac ttttgccatt ctcaccggat tcagtcgtca ctcatggtga tttctcactt
     5161 gataacctta tttttgacga ggggaaatta ataggttgta ttgatgttgg acgagtcgga
     5221 atcgcagacc gataccagga tcttgccatc ctatggaact gcctcggtga gttttctcct
     5281 tcattacaga aacggctttt tcaaaaatat ggtattgata atcctgatat gaataaattg
     5341 cagtttcatt tgatgctcga tgagtttttc taagaattaa ttcatgagcg gatacatatt
     5401 tgaatgtatt tagaaaaata aacaaatagg ggttccgcgc acatttcccc gaaaagtgcc
     5461 acctgaaatt gtaaacgtta atattttgtt aaaattcgcg ttaaattttt gttaaatcag
     5521 ctcatttttt aaccaatagg ccgaaatcgg caaaatccct tataaatcaa aagaatagac
     5581 cgagataggg ttgagtgttg ttccagtttg gaacaagagt ccactattaa agaacgtgga
     5641 ctccaacgtc aaagggcgaa aaaccgtcta tcagggcgat ggcccactac gtgaaccatc
     5701 accctaatca agttttttgg ggtcgaggtg ccgtaaagca ctaaatcgga accctaaagg
     5761 gagcccccga tttagagctt gacggggaaa gccggcgaac gtggcgagaa aggaagggaa
     5821 gaaagcgaaa ggagcgggcg ctagggcgct ggcaagtgta gcggtcacgc tgcgcgtaac
     5881 caccacaccc gccgcgctta atgcgccgct acagggcgcg tcccattcgc ca


Product is for research use only!

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
