pET- 39b


  • Model: PVT0095
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pET-39b,Plasmid pET-39b,pET-39b vector

Bacterial Resistance:Kanamycin
Growth Strain:DH5α
Expression: Bacterial
Use:pET Plasmid

pET-39b Plasmid informaiton

Promoter: T7/lac
Replicator: ColE1, ori, F1, ori
Terminator: T7 Terminator
Plasmid classification: Escherichia coli vector, PET series of expressed plasmids
Plasmid size: 6106bp
Plasmid labels: N-6 * His, N-DsbA, N-S, N-EK, N-Thrombin, C-6 * His
Prokaryotic resistance: kanamycin Kan
Clone strain: DH5 alpha
Culture conditions: 37 DEG C, aerobic, LB
Expression host: BL21 (DE3)
Culture conditions: 37 DEG C, aerobic, LB
Induction: IPTG or lactose and its analogues
Primers for 5'sequencing: T7:TAATACGACTCACTATAGGG
Primers for 3'sequencing: T7-ter:TGCTAGTTATTGCTCAGCGG
Note: DsbA fusion protein is expressed


pET-39b Plasmid Description

The pET-39b(+) vector is designed for expression of DsbA fusion proteins. Unique sites are shown on the circle map. Note that the sequence is numbered by the pBR322 convention, so the T7 expression region is reversed on the circle map. The cloning/expression region of the coding strand transcribed by T7 RNA polymerase is shown below. The f1 origin is oriented so that infection with helper phage will produce virions containing single stranded DNA that corresponds to the coding strand. Therefore, single stranded sequencing should be performed using the T7 terminator primer .

pET-39b Plasmid Sequence

LOCUS       Exported                6106 bp ds-DNA     circular SYN 10-8-2015
DEFINITION  synthetic circular DNA
KEYWORDS    Untitled 2
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 6106)
  TITLE     Direct Submission
  JOURNAL   Exported 2015-8-10  
FEATURES             Location/Qualifiers
     source          1..6106
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     source          1039..1061
                     /organism="Enterobacteria phage T7"
                     /mol_type="genomic DNA"
     terminator      26..73
                     /note="T7 terminator"
                     /note="transcription terminator for bacteriophage T7 RNA
     CDS             complement(150..173)
                     /product="8xHis affinity tag"
     CDS             complement(252..266)
                     /product="enterokinase recognition and cleavage site"
                     /note="enterokinase site"
     CDS             complement(282..326)
                     /product="affinity and epitope tag derived from pancreatic
                     ribonuclease A"
     CDS             complement(342..359)
                     /product="thrombin recognition and cleavage site"
                     /note="thrombin site"
     CDS             complement(369..386)
                     /product="6xHis affinity tag"
     CDS             complement(408..1031)
                     /product="bacterial periplasmic oxidoreductase"
     RBS             1039..1061
                     /note="efficient ribosome binding site from bacteriophage
                     T7 gene 10 (Olins and Rangwala, 1989)"
     protein_bind    1076..1100
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(1101..1119)
                     /note="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     promoter        1432..1509
                     /note="lacI promoter"
     CDS             1510..2592
                     /product="lac repressor"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     CDS             3401..3592
                     /product="Rop protein, which maintains plasmids at low copy

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
