pET- 41b


  • Model: PVT0098
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pET-41b,Plasmid pET-41b,pET-41b vector


pET-41b Plasmid information

Promoter: T7/lac
Replicon: ColE1 ori, F1 ori
Terminator: T7 Terminator
Plasmid classification: Escherichia coli vector; PET series expression plasmid
Plasmid size: 5932bp
Plasmid Tags: N-GST, N-6 * His, N-Thrombin
Prokaryotic resistance: kanamycin Kan
Clone strain: DH5 alpha
Culture conditions: 37, aerobic, LB
Expression host: BL21 (DE3)
Culture conditions: 37, aerobic, LB
Induction: IPTG or lactose and its analogues
Primers for 5'sequencing: T7:TAATACGACTCACTATAGGG
Primers for 3'sequencing: T7-ter:TGCTAGTTATTGCTCAGCGG

Use:pET Plasmid

pET-41b  Sequence

LOCUS       Exported                5932 bp ds-DNA     circular SYN 10-8-2015
DEFINITION  synthetic circular DNA
KEYWORDS    Untitled 2
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 5932)
  TITLE     Direct Submission
  JOURNAL   Exported 2015-8-10     
FEATURES             Location/Qualifiers
     source          1..5932
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     source          1102..1124
                     /organism="Enterobacteria phage T7"
                     /mol_type="genomic DNA"
     terminator      26..73
                     /note="T7 terminator"
                     /note="transcription terminator for bacteriophage T7 RNA
     CDS             complement(150..173)
                     /product="8xHis affinity tag"
     CDS             complement(264..278)
                     /product="enterokinase recognition and cleavage site"
                     /note="enterokinase site"
     CDS             complement(309..353)
                     /product="affinity and epitope tag derived from pancreatic
                     ribonuclease A"
     CDS             complement(369..386)
                     /product="thrombin recognition and cleavage site"
                     /note="thrombin site"
     CDS             complement(396..413)
                     /product="6xHis affinity tag"
     CDS             complement(441..1094)
                     /product="glutathione S-transferase from Schistosoma
     RBS             1102..1124
                     /note="efficient ribosome binding site from bacteriophage
                     T7 gene 10 (Olins and Rangwala, 1989)"
     protein_bind    1139..1163
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(1164..1182)
                     /note="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     promoter        1495..1572
                     /note="lacI promoter"
     CDS             1573..2655
                     /product="lac repressor"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     CDS             3227..3418
                     /product="Rop protein, which maintains plasmids at low copy
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
