pET- 41c


  • Model: PVT10581
  • 50 Units in Stock
Ask a question

Add to Cart:


Catalog No. PVT10581
Packing 2ug


pET-41c Information

Promoter: T7/lac promoter

Copier: ColE1 ori, F1 ori

Terminator: T7 Terminator

Plasmid size: 5934bp

Plasmid Label: N-GST, N-6*His, N-Thrombin

Prokaryotic resistance: kanamycin Kan

Clonal strain: DH5 alpha

Culture conditions: 37 C, aerobic, LB

Expression host: BL21 (DE3)

Culture conditions: 37 C, aerobic, LB

Induction: IPTG or lactose and its analogues

5'Sequencing Primers: T7:TAATACGACTCACTATAGG

3'Sequencing Primer: T7-ter: TGCTAGTTATTGCTCAGCGG


pET-41c Description

PET41 series vectors are designed to clone and express proteins at high level. The vectors fuse and express a purified fragment of GST tagged protein containing 220 amino acids. The single polyclonal site of pET41a vector is shown in the circular plasmid map above. Note: The vector sequence is encoded by the coding rules of the pBR322 plasmid, so the expression region of T7 protein is reversed on the plasmid map.

The cloning and expression regions initiated by T7 RNA polymerase were also labeled in the plasmid map. The F1 replicon of the plasmid is directed, so viral particles containing protein coding sequence can be produced by T7 phage polymerase, and the protein expression will be terminated by T7 terminator sequence.

The pET-41a vector contains an EK protease cleavage site. When the target gene is inserted into the vector using the PSAI restriction endonuclease site on the vector, all the fusion amino acid sequences on the vector, including GST tag sequences, can be removed by EK protease.


pET-41c Multiple cloning site





pET-41c Sequence

LOCUS       Exported                5934 bp ds-DNA     circular SYN 31-AUG-2016
DEFINITION  synthetic circular DNA
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 5934)
  TITLE     Direct Submission
FEATURES             Location/Qualifiers
     source          1..5934
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     terminator      26..73
                     /note="T7 terminator"
                     /note="transcription terminator for bacteriophage T7 RNA
     CDS             complement(150..173)
                     /product="8xHis affinity tag"
     CDS             complement(266..280)
                     /product="enterokinase recognition and cleavage site"
                     /note="enterokinase site"
     CDS             complement(311..355)
                     /product="affinity and epitope tag derived from pancreatic
                     ribonuclease A"
     CDS             complement(371..388)
                     /product="thrombin recognition and cleavage site"
                     /note="thrombin site"
     CDS             complement(398..415)
                     /product="6xHis affinity tag"
     CDS             complement(443..1096)
                     /product="glutathione S-transferase from Schistosoma
     protein_bind    1141..1165
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(1166..1184)
                     /note="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     promoter        1497..1574
                     /note="lacI promoter"
     CDS             1575..2657
                     /product="lac repressor"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     CDS             3229..3420
                     /product="Rop protein"
     rep_origin      complement(3850..4438)
                     /note="high-copy-number colE1/pMB1/pBR322/pUC origin of
     CDS             4560..5375
                     /product="aminoglycoside phosphotransferase"
                     /note="confers resistance to kanamycin"
     rep_origin      complement(5468..5923)
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
        1 atccggatat agttcctcct ttcagcaaaa aacccctcaa gacccgttta gaggccccaa
       61 ggggttatgc tagttattgc tcagcggtgg cagcagccaa ctcagcttcc tttcgggctt
      121 tgtttagcag cctaggtatt aatcaattag tggtggtggt ggtggtggtg gtgctcgagt
      181 gcggccgcaa gcttgtcgac ggagctcgcc tgcaggcgcg ccaaggcctg tacagaattc
      241 ggatccccga tatcgccatg ggactcttgt cgtcgtcatc accggagcca ccaccggtac
      301 ccagatctgg gctgtccatg tgctggcgtt cgaatttagc agcagcggtt tctttcatac
      361 caattgcagt actaccgcgt ggcaccagac ccgcggagtg atggtgatgg tgatgaccag
      421 aaccactagt tgaaccatcc gattttggag gatggtcgcc accaccaaac gtggcttgcc
      481 agccctgcaa aggccatgct atatacttgc tggatttcaa gtacttatca atttgtggga
      541 tagcttcaat acgtttttta aaacaaacta attttgggaa cgcatccagg cacattgggt
      601 ccatgtataa aacaacatca agagcgtcat acaacatgaa gtcaggatgg gttacatgat
      661 caccatttaa atatgtttta tgacataaac gatcttcgaa cattttcagc atttcaggta
      721 gcttgctaag aaaatcaact ttgagagttt caaagtcttt actatatgca attctcgaaa
      781 caccgtatct aatatccaaa accgctcctt caagcattga aatctctgca cgctcttttg
      841 gacaaccacc caacatgttg tgcttgtcag ctatataacg tatgatggcc atagactgtg
      901 ttaatttaac atcaccatca atataataag gaagattggg aaactccaaa cccaattcaa
      961 actttttgtt tcgccattta tcaccttcat cgcgctcata caaatgctct tcatattttt
     1021 cttcaagata ttccaaaaga agtcgagtgg gttgcacaag gcccttaatt ttccaataac
     1081 ctagtatagg ggacatatgt atatctcctt cttaaagtta aacaaaatta tttctagagg
     1141 ggaattgtta tccgctcaca attcccctat agtgagtcgt attaatttcg cgggatcgag
     1201 atcgatctcg atcctctacg ccggacgcat cgtggccggc atcaccggcg ccacaggtgc
     1261 ggttgctggc gcctatatcg ccgacatcac cgatggggaa gatcgggctc gccacttcgg
     1321 gctcatgagc gcttgtttcg gcgtgggtat ggtggcaggc cccgtggccg ggggactgtt
     1381 gggcgccatc tccttgcatg caccattcct tgcggcggcg gtgctcaacg gcctcaacct
     1441 actactgggc tgcttcctaa tgcaggagtc gcataaggga gagcgtcgag atcccggaca
     1501 ccatcgaatg gcgcaaaacc tttcgcggta tggcatgata gcgcccggaa gagagtcaat
     1561 tcagggtggt gaatgtgaaa ccagtaacgt tatacgatgt cgcagagtat gccggtgtct
     1621 cttatcagac cgtttcccgc gtggtgaacc aggccagcca cgtttctgcg aaaacgcggg
     1681 aaaaagtgga agcggcgatg gcggagctga attacattcc caaccgcgtg gcacaacaac
     1741 tggcgggcaa acagtcgttg ctgattggcg ttgccacctc cagtctggcc ctgcacgcgc
     1801 cgtcgcaaat tgtcgcggcg attaaatctc gcgccgatca actgggtgcc agcgtggtgg
     1861 tgtcgatggt agaacgaagc ggcgtcgaag cctgtaaagc ggcggtgcac aatcttctcg
     1921 cgcaacgcgt cagtgggctg atcattaact atccgctgga tgaccaggat gccattgctg
     1981 tggaagctgc ctgcactaat gttccggcgt tatttcttga tgtctctgac cagacaccca
     2041 tcaacagtat tattttctcc catgaagacg gtacgcgact gggcgtggag catctggtcg
     2101 cattgggtca ccagcaaatc gcgctgttag cgggcccatt aagttctgtc tcggcgcgtc
     2161 tgcgtctggc tggctggcat aaatatctca ctcgcaatca aattcagccg atagcggaac
     2221 gggaaggcga ctggagtgcc atgtccggtt ttcaacaaac catgcaaatg ctgaatgagg
     2281 gcatcgttcc cactgcgatg ctggttgcca acgatcagat ggcgctgggc gcaatgcgcg
     2341 ccattaccga gtccgggctg cgcgttggtg cggacatctc ggtagtggga tacgacgata
     2401 ccgaagacag ctcatgttat atcccgccgt taaccaccat caaacaggat tttcgcctgc
     2461 tggggcaaac cagcgtggac cgcttgctgc aactctctca gggccaggcg gtgaagggca
     2521 atcagctgtt gcccgtctca ctggtgaaaa gaaaaaccac cctggcgccc aatacgcaaa
     2581 ccgcctctcc ccgcgcgttg gccgattcat taatgcagct ggcacgacag gtttcccgac
     2641 tggaaagcgg gcagtgagcg caacgcaatt aatgtaagtt agctcactca ttaggcaccg
     2701 ggatctcgac cgatgccctt gagagccttc aacccagtca gctccttccg gtgggcgcgg
     2761 ggcatgacta gcatgatcgt gctcctgtcg ttgaggaccc ggctaggctg gcggggttgc
     2821 cttactggtt agcagaatga atcaccgata cgcgagcgaa cgtgaagcga ctgctgctgc
     2881 aaaacgtctg cgacctgagc aacaacatga atggtcttcg gtttccgtgt ttcgtaaagt
     2941 ctggaaacgc ggaagtcagc gccctgcacc attatgttcc ggatctgcat cgcaggatgc
     3001 tgctggctac cctgtggaac acctacatct gtattaacga agcgctggca ttgaccctga
     3061 gtgatttttc tctggtcccg ccgcatccat accgccagtt gtttaccctc acaacgttcc
     3121 agtaaccggg catgttcatc atcagtaacc cgtatcgtga gcatcctctc tcgtttcatc
     3181 ggtatcatta cccccatgaa cagaaatccc ccttacacgg aggcatcagt gaccaaacag
     3241 gaaaaaaccg cccttaacat ggcccgcttt atcagaagcc agacattaac gcttctggag
     3301 aaactcaacg agctggacgc ggatgaacag gcagacatct gtgaatcgct tcacgaccac
     3361 gctgatgagc tttaccgcag ctgcctcgcg cgtttcggtg atgacggtga aaacctctga
     3421 cacatgcagc tcccggagac ggtcacagct tgtctgtaag cggatgccgg gagcagacaa
     3481 gcccgtcagg gcgcgtcagc gggtgttggc gggtgtcggg gcgcagccat gacccagtca
     3541 cgtagcgata gcggagtgta tactggctta actatgcggc atcagagcag attgtactga
     3601 gagtgcacca tatatgcggt gtgaaatacc gcacagatgc gtaaggagaa aataccgcat
     3661 caggcgctct tccgcttcct cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg
     3721 agcggtatca gctcactcaa aggcggtaat acggttatcc acagaatcag gggataacgc
     3781 aggaaagaac atgtgagcaa aaggccagca aaaggccagg aaccgtaaaa aggccgcgtt
     3841 gctggcgttt ttccataggc tccgcccccc tgacgagcat cacaaaaatc gacgctcaag
     3901 tcagaggtgg cgaaacccga caggactata aagataccag gcgtttcccc ctggaagctc
     3961 cctcgtgcgc tctcctgttc cgaccctgcc gcttaccgga tacctgtccg cctttctccc
     4021 ttcgggaagc gtggcgcttt ctcatagctc acgctgtagg tatctcagtt cggtgtaggt
     4081 cgttcgctcc aagctgggct gtgtgcacga accccccgtt cagcccgacc gctgcgcctt
     4141 atccggtaac tatcgtcttg agtccaaccc ggtaagacac gacttatcgc cactggcagc
     4201 agccactggt aacaggatta gcagagcgag gtatgtaggc ggtgctacag agttcttgaa
     4261 gtggtggcct aactacggct acactagaag gacagtattt ggtatctgcg ctctgctgaa
     4321 gccagttacc ttcggaaaaa gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg
     4381 tagcggtggt ttttttgttt gcaagcagca gattacgcgc agaaaaaaag gatctcaaga
     4441 agatcctttg atcttttcta cggggtctga cgctcagtgg aacgaaaact cacgttaagg
     4501 gattttggtc atgaacaata aaactgtctg cttacataaa cagtaataca aggggtgtta
     4561 tgagccatat tcaacgggaa acgtcttgct ctaggccgcg attaaattcc aacatggatg
     4621 ctgatttata tgggtataaa tgggctcgcg ataatgtcgg gcaatcaggt gcgacaatct
     4681 atcgattgta tgggaagccc gatgcgccag agttgtttct gaaacatggc aaaggtagcg
     4741 ttgccaatga tgttacagat gagatggtca gactaaactg gctgacggaa tttatgcctc
     4801 ttccgaccat caagcatttt atccgtactc ctgatgatgc atggttactc accactgcga
     4861 tccccgggaa aacagcattc caggtattag aagaatatcc tgattcaggt gaaaatattg
     4921 ttgatgcgct ggcagtgttc ctgcgccggt tgcattcgat tcctgtttgt aattgtcctt
     4981 ttaacagcga tcgcgtattt cgtctcgctc aggcgcaatc acgaatgaat aacggtttgg
     5041 ttgatgcgag tgattttgat gacgagcgta atggctggcc tgttgaacaa gtctggaaag
     5101 aaatgcataa acttttgcca ttctcaccgg attcagtcgt cactcatggt gatttctcac
     5161 ttgataacct tatttttgac gaggggaaat taataggttg tattgatgtt ggacgagtcg
     5221 gaatcgcaga ccgataccag gatcttgcca tcctatggaa ctgcctcggt gagttttctc
     5281 cttcattaca gaaacggctt tttcaaaaat atggtattga taatcctgat atgaataaat
     5341 tgcagtttca tttgatgctc gatgagtttt tctaagaatt aattcatgag cggatacata
     5401 tttgaatgta tttagaaaaa taaacaaata ggggttccgc gcacatttcc ccgaaaagtg
     5461 ccacctgaaa ttgtaaacgt taatattttg ttaaaattcg cgttaaattt ttgttaaatc
     5521 agctcatttt ttaaccaata ggccgaaatc ggcaaaatcc cttataaatc aaaagaatag
     5581 accgagatag ggttgagtgt tgttccagtt tggaacaaga gtccactatt aaagaacgtg
     5641 gactccaacg tcaaagggcg aaaaaccgtc tatcagggcg atggcccact acgtgaacca
     5701 tcaccctaat caagtttttt ggggtcgagg tgccgtaaag cactaaatcg gaaccctaaa
     5761 gggagccccc gatttagagc ttgacgggga aagccggcga acgtggcgag aaaggaaggg
     5821 aagaaagcga aaggagcggg cgctagggcg ctggcaagtg tagcggtcac gctgcgcgta
     5881 accaccacac ccgccgcgct taatgcgccg ctacagggcg cgtcccattc gcca


No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
