pET- DsbA Plasmid

$182.00

  • Model: PVT0384
  • 50 Units in Stock
Ask a question


Add to Cart:

pET-DsbA

Search name

pET-DsbA,Plasmid pET-DsbA,pET-DsbA vector

pET-DsbA Plasmid information

Promoter: T7/lac
Replicon: ColE1 ori, F1 ori
Terminator: T7 Terminator
Plasmid classification: Escherichia coli vector; PET series expression plasmid
Plasmid size: 3.6kb
Plasmid Tags: N-6 x His, N-DsbA, -N-Thromas
Prokaryotic resistance: ampicillin Amp
Clone strain: DH5 alpha
Culture conditions: 37, aerobic, LB
Expression host: BL21 (DE3)
Culture conditions: 37, aerobic, LB
Induction: IPTG or lactose and its analogues
Primers for 5'sequencing: T7:TAATACGACTCACTATAGGG
Primers for 3'sequencing: T7-ter:TGCTAGTTATTGCTCAGCGG

pET-DsbA-plasmid

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart