pET- GST Plasmid

$182.00

  • Model: PVT0381
  • 50 Units in Stock
Ask a question


Add to Cart:

pET-GST

Search name

pET-GST,Plasmid pET-GST,pET-GST vector

 

 

pET-GST Informaiton

Promoter: T7/lac

Replicon: ColE1 ori, F1 ori

Terminator: T7 Terminator

Plasmid classification: Escherichia coli vector; PET series expression plasmid

Plasmid size: 3.7kb

Plasmid tagging: N-GST, C-6 x His, N-P3C

Prokaryotic resistance: ampicillin Amp

Clonal strain: DH5 alpha

Culture conditions: 37 C, aerobic, LB

Expression host: BL21 (DE3)

Culture conditions: 37 C, aerobic, LB

Induction: IPTG or lactose and its analogues.

5'sequencing primers: T7:TAATACGACTCACTATAGGG

3'sequencing primers: T7-ter:TGCTAGTTATTGCTCAGCGG

 

pET-GST Description

pET-GST expression vector was fused with T7 promoter and GST, and the specific cleavage site of human rhinovirus 14 subtype 3C protease was selected. In addition, the C terminal also added 6 His, which is easy to use chelating Sepharose affinity chromatography. The fusion protein expressed in this vector can be purified by affinity chromatography with GST adsorption and double affinity chromatography with six His chelating sepharose. The background literature of GST fusion expression is very rich in medline, and hundreds of genes have been successfully expressed by GST fusion.

 

 

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart