pET- Trx

$288.00

  • Model: PVT0382
  • 50 Units in Stock
Ask a question


Add to Cart:

pET-Trx

PVT0382    2ug

 

pET-Trx Information

Promoter: T7/lac

Replicator: ColE1 ori, F1 ori

Terminator: T7 Terminator

Plasmid classification: Escherichia coli vector; PET series expression plasmid

Plasmid size: 3.3kb

Plasmid label: N-TRX, N-P3C

Prokaryotic resistance: ampicillin Amp

Cloned strain: Escherichia coli DH5 alpha

Culture conditions: 37 centigrade, aerobic, LB

Expression host: BL21 (DE3)

Culture conditions: 37 centigrade, aerobic, LB

Inducement: IPTG or lactose and its analogues

5'sequencing primers: T7:TAATACGACTCACTATAGGG

3'sequencing primers: T7-ter:TGCTAGTTATTGCTCAGCGG

 

pET-Trx Description

PET-Trx is a pET series expression plasmid of Escherichia coli.

pET-Trx-vector

 

pET-Trx Sequence (Expression functional region)

ORIGIN
        1 tctagaaata attttgttta actttaagaa ggagatatac atatgtctga taaaattatt
       61 catctgactg atgattcttt tgatactgat gtacttaagg cagatggtgc aatcctggtt
      121 gatttctggg cacactggtg cggtccgtgc aaaatgatcg ctccgattct ggatgaaatc
      181 gctgacgaat atcagggcaa actgaccgtt gcaaaactga acatcgatca caacccgggc
      241 actgcgccga aatatggcat ccgtggtatc ccgactctgc tgctgttcaa aaacggtgaa
      301 gtggcggcaa ccaaagtggg tgcactgtct aaaggtcagt tgaaagagtt cctcgacgct
      361 aacctggctg gctctagcat gccagactct ctcgaagttc tgtttcaggg tccagcagga
      421 tccgcagaat tcagcgctag ctaacatcat catcatcatt aagctt  
//
 
Caution:
Product is for research use only!
 
 

Search name

pET-Trx,Plasmid pET-Trx,pET-Trx vector

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart