pET-21a(+)-2019-nCoV-S

$260.00

  • Model: PVT19765
  • 50 Units in Stock
Ask a question


Add to Cart:

pET-21a(+)-2019-nCoV-S

PVT19765     2ug

 

pET-21a(+)-2019-nCoV-S Information

Promoter: T7

Replicator: pBR322

Terminator: T7 Terminator

Plasmid classification: Escherichia coli vector; pet series expression plasmid

Plasmid size: 9186 bp

Plasmid label: n-t7, c-his

Prokaryotic resistance: Amp

Clone strain: DH5a

Culture condition: 37 ℃

Expression host: Escherichia coli BL21 (DE3)

Culture condition: 37 ℃, aerobic, LB

Induction method: IPTG or lactose and its analogues

 

pET-21a(+)-2019-nCoV-S Sequence

tggcgaatgggacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttg
ccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctcta
aatcgggggctccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttc
acgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgt
tccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggattttgccgatttcggcctattgg
ttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaaaatattaacgtttacaatttcaggtggcacttt
tcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataac
cctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattccctttttt
gcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacg
agtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatga
gcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacac
tattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatg
cagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccg
cttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgac
gagcgtgacaccacgatgcctgcagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttc
ccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggt
ttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcc
cgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctc
actgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaattta
aaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtca
gaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaacc
accgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgc
agataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctc
gctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagtt
accggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaac
tgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggc
agggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgcca
cctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttt
tacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtatt
accgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaaga
gcgcctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatatggtgcactctcagtacaatctg
ctctgatgccgcatagttaagccagtatacactccgctatcgctacgtgactgggtcatggctgcgccccgacacccgcc
aacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagct
gcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgaggcagctgcggtaaagctcatcagcgtggtcgtgaagc
gattcacagatgtctgcctgttcatccgcgtccagctcgttgagtttctccagaagcgttaatgtctggcttctgataaa
gcgggccatgttaagggcggttttttcctgtttggtcactgatgcctccgtgtaagggggatttctgttcatgggggtaa
tgataccgatgaaacgagagaggatgctcacgatacgggttactgatgatgaacatgcccggttactggaacgttgtgag
ggtaaacaactggcggtatggatgcggcgggaccagagaaaaatcactcagggtcaatgccagcgcttcgttaatacaga
tgtaggtgttccacagggtagccagcagcatcctgcgatgcagatccggaacataatggtgcagggcgctgacttccgcg
tttccagactttacgaaacacggaaaccgaagaccattcatgttgttgctcaggtcgcagacgttttgcagcagcagtcg
cttcacgttcgctcgcgtatcggtgattcattctgctaaccagtaaggcaaccccgccagcctagccgggtcctcaacga
caggagcacgatcatgcgcacccgtggggccgccatgccggcgataatggcctgcttctcgccgaaacgtttggtggcgg
gaccagtgacgaaggcttgagcgagggcgtgcaagattccgaataccgcaagcgacaggccgatcatcgtcgcgctccag
cgaaagcggtcctcgccgaaaatgacccagagcgctgccggcacctgtcctacgagttgcatgataaagaagacagtcat
aagtgcggcgacgatagtcatgccccgcgcccaccggaaggagctgactgggttgaaggctctcaagggcatcggtcgag
atcccggtgcctaatgagtgagctaacttacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcg
tgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgccagggtggtttttcttttca
ccagtgagacgggcaacagctgattgcccttcaccgcctggccctgagagagttgcagcaagcggtccacgctggtttgc
cccagcaggcgaaaatcctgtttgatggtggttaacggcgggatataacatgagctgtcttcggtatcgtcgtatcccac
taccgagatatccgcaccaacgcgcagcccggactcggtaatggcgcgcattgcgcccagcgccatctgatcgttggcaa
ccagcatcgcagtgggaacgatgccctcattcagcatttgcatggtttgttgaaaaccggacatggcactccagtcgcct
tcccgttccgctatcggctgaatttgattgcgagtgagatatttatgccagccagccagacgcagacgcgccgagacaga
acttaatgggcccgctaacagcgcgatttgctggtgacccaatgcgaccagatgctccacgcccagtcgcgtaccgtctt
catgggagaaaataatactgttgatgggtgtctggtcagagacatcaagaaataacgccggaacattagtgcaggcagct
tccacagcaatggcatcctggtcatccagcggatagttaatgatcagcccactgacgcgttgcgcgagaagattgtgcac
cgccgctttacaggcttcgacgccgcttcgttctaccatcgacaccaccacgctggcacccagttgatcggcgcgagatt
taatcgccgcgacaatttgcgacggcgcgtgcagggccagactggaggtggcaacgccaatcagcaacgactgtttgccc
gccagttgttgtgccacgcggttgggaatgtaattcagctccgccatcgccgcttccactttttcccgcgttttcgcaga
aacgtggctggcctggttcaccacgcgggaaacggtctgataagagacaccggcatactctgcgacatcgtataacgtta
ctggtttcacattcaccaccctgaattgactctcttccgggcgctatcatgccataccgcgaaaggttttgcgccattcg
atggtgtccgggatctcgacgctctcccttatgcgactcctgcattaggaagcagcccagtagtaggttgaggccgttga
gcaccgccgccgcaaggaatggtgcatgcaaggagatggcgcccaacagtcccccggccacggggcctgccaccataccc
acgccgaaacaagcgctcatgagcccgaagtggcgagcccgatcttccccatcggtgatgtcggcgatataggcgccagc
aaccgcacctgtggcgccggtgatgccggccacgatgcgtccggcgtagaggatcgagatctcgatcccgcgaaattaat
acgactcactataggggaattgtgagcggataacaattcccctctagaaataattttgtttaactttaagaaggagatat
acatATGTTTGTGTTTCTGGTGCTGCTGCCGCTCGTCTCTTCTCAGTGTGTTAATCTGACCACCCGTACCCAGCTGCCGC
CGGCATATACCAATAGCTTTACCCGCGGCGTGTATTATCCGGATAAAGTGTTTCGTAGTTCAGTGCTGCATAGCACCCAG
GATCTGTTTCTGCCGTTTTTTAGTAATGTTACCTGGTTTCATGCAATTCATGTGAGCGGCACCAATGGTACCAAACGCTT
TGATAATCCGGTGCTGCCGTTTAATGATGGCGTGTATTTTGCATCAACCGAAAAATCAAATATTATTCGCGGTTGGATTT
TTGGTACCACCCTGGATAGTAAAACCCAGTCACTGCTGATTGTGAATAATGCAACCAATGTGGTTATTAAAGTGTGTGAA
TTTCAGTTTTGTAATGATCCGTTTCTGGGCGTGTATTATCATAAAAATAATAAATCTTGGATGGAAAGCGAATTTCGCGT
GTATAGTAGCGCAAATAATTGTACCTTTGAATATGTGTCACAGCCGTTTCTGATGGATCTGGAAGGTAAACAGGGTAATT
TTAAAAATCTGCGCGAATTTGTGTTTAAAAATATTGATGGCTATTTTAAAATTTATAGCAAACATACCCCGATTAATCTG
GTGCGCGATCTGCCGCAGGGCTTTAGCGCACTGGAACCGCTGGTTGATCTGCCGATTGGCATTAATATTACCCGCTTTCA
GACCCTGCTGGCACTGCATCGCTCTTATCTGACTCCAGGCGATAGCTCAAGCGGTTGGACCGCAGGCGCAGCAGCATATT
ATGTTGGCTATCTCCAGCCGCGTACCTTTCTGCTGAAATATAATGAAAATGGTACCATTACCGATGCAGTTGATTGTGCA
CTTGACCCTTTATCTGAAACCAAATGTACCCTGAAATCATTTACCGTGGAAAAAGGCATTTATCAGACCTCTAATTTTCG
CGTTCAGCCGACCGAAAGCATTGTTCGCTTTCCGAATATTACCAATCTGTGTCCGTTTGGCGAAGTGTTTAATGCAACCC
GCTTTGCAAGCGTGTATGCATGGAATCGTAAACGTATTAGCAATTGTGTTGCAGATTATAGCGTGCTGTATAATAGCGCA
TCATTTTCAACCTTTAAATGTTATGGCGTTAGTCCGACCAAACTGAATGATCTGTGTTTTACCAATGTGTATGCAGATAG
CTTTGTTATTCGCGGCGATGAAGTGCGCCAGATTGCACCGGGCCAGACCGGCAAAATTGCAGATTATAATTATAAACTGC
CGGATGATTTTACCGGCTGTGTTATTGCATGGAATAGTAATAATCTGGATTCTAAAGTGGGTGGTAATTATAATTATCTG
TATCGCCTGTTTCGTAAAAGCAATCTGAAACCGTTTGAACGCGATATTTCAACCGAAATTTATCAGGCAGGCTCAACCCC
GTGTAATGGCGTGGAAGGCTTTAATTGTTATTTTCCGCTTCAGAGCTATGGCTTTCAGCCGACCAATGGCGTGGGCTATC
AGCCGTATCGCGTGGTGGTGCTGTCATTTGAACTGCTCCATGCACCGGCAACCGTTTGTGGTCCGAAAAAATCAACCAAT
CTGGTGAAAAATAAATGTGTGAATTTTAATTTTAATGGCCTGACCGGTACCGGCGTGCTGACCGAATCAAATAAAAAATT
TCTGCCGTTTCAGCAGTTTGGTCGCGATATTGCAGATACCACCGATGCAGTTCGCGATCCGCAGACCCTGGAAATTCTGG
ATATTACCCCGTGTAGCTTTGGCGGCGTGAGTGTTATTACGCCTGGTACCAATACCTCTAATCAGGTGGCAGTGCTGTAT
CAGGATGTGAATTGTACCGAAGTTCCGGTGGCAATTCATGCAGATCAGCTGACCCCGACCTGGCGCGTGTATAGCACCGG
CTCTAATGTGTTTCAGACCCGCGCAGGTTGTCTGATTGGCGCAGAACATGTGAATAATAGCTATGAATGTGATATTCCGA
TTGGCGCAGGCATTTGTGCAAGCTATCAGACCCAGACCAATAGTCCGCGTCGCGCACGCTCAGTGGCATCACAGTCTATT
ATTGCATATACCATGAGCCTGGGCGCAGAAAATTCAGTTGCATATAGTAATAATTCTATTGCAATTCCGACCAATTTTAC
CATTAGCGTGACCACCGAAATTCTGCCGGTTAGTATGACCAAAACCTCAGTTGATTGTACCATGTATATTTGTGGCGATT
CAACCGAATGTAGTAATCTGCTGCTACAATATGGTAGCTTTTGTACCCAGCTGAATCGCGCACTGACCGGCATTGCAGTG
GAACAGGATAAAAATACCCAGGAAGTGTTTGCACAGGTTAAACAGATTTATAAAACCCCGCCGATTAAAGATTTTGGTGG
CTTTAATTTTAGCCAGATTCTGCCGGACCCGTCTAAACCGTCTAAACGCTCATTTATTGAGGACCTGCTGTTTAATAAAG
TGACCCTGGCAGATGCAGGCTTTATTAAACAGTATGGTGATTGTCTGGGCGATATTGCAGCACGCGATCTGATTTGTGCA
CAGAAATTTAATGGCCTGACCGTTCTGCCGCCGCTGCTGACCGATGAAATGATTGCACAGTATACCTCAGCACTGCTGGC
AGGTACCATTACCAGCGGTTGGACCTTTGGCGCAGGCGCAGCACTACAGATTCCGTTTGCAATGCAGATGGCATATCGCT
TTAATGGCATTGGCGTTACCCAGAATGTTCTGTATGAAAATCAGAAACTGATTGCAAATCAGTTTAATAGCGCAATTGGT
AAAATTCAGGATAGCCTGTCTTCAACCGCAAGCGCACTGGGTAAACTTCAAGATGTGGTGAATCAGAATGCACAGGCACT
GAATACCCTGGTTAAACAGCTGTCAAGCAATTTTGGCGCAATTAGTAGCGTGCTGAATGATATTCTGTCACGCCTGGATA
AAGTGGAAGCAGAAGTTCAGATTGATCGCCTGATTACCGGTCGCCTCCAGTCACTTCAAACCTATGTGACCCAGCAGCTG
ATTCGCGCAGCAGAAATTCGCGCAAGCGCAAATCTGGCAGCAACCAAAATGAGCGAATGTGTTCTGGGCCAGTCTAAGCG
AGTTGATTTTTGTGGTAAAGGCTATCATCTGATGAGCTTTCCGCAGTCAGCACCGCATGGCGTGGTTTTTCTGCATGTGA
CCTATGTTCCGGCACAGGAAAAAAATTTTACCACCGCACCGGCAATTTGTCATGATGGTAAAGCACATTTTCCGCGCGAA
GGCGTGTTTGTGAGTAATGGCACCCATTGGTTTGTGACCCAGCGTAATTTTTATGAACCGCAGATTATTACCACCGATAA
TACCTTTGTGAGCGGTAATTGTGATGTGGTTATTGGCATTGTTAATAATACCGTTTATGATCCGTTACAGCCGGAACTGG
ATAGCTTTAAAGAAGAACTGGATAAATATTTTAAAAATCATACCTCTCCGGATGTTGATCTGGGCGATATTAGCGGCATT
AATGCAAGCGTGGTGAATATTCAGAAAGAAATTGATCGTCTGAATGAAGTTGCAAAAAATCTGAATGAAAGCCTGATTGA
TCTACAAGAACTGGGCAAATATGAACAGTATATTAAATGGCCGTGGTATATTTGGCTGGGCTTTATTGCAGGCCTGATTG
CAATTGTTATGGTGACCATTATGCTGTGTTGTATGACCTCTTGTTGTTCTTGTCTGAAAGGTTGTTGTAGTTGTGGCTCT
TGTTGTAAATTTGATGAAGATGATAGCGAACCGGTGCTGAAAGGCGTTAAACTGCATTATACCctcgagcaccaccacca
ccaccactgagatccggctgctaacaaagcccgaaaggaagctgagttggctgctgccaccgctgagcaataactagcat
aaccccttggggcctctaaacgggtcttgaggggttttttgctgaaaggaggaactatatccggat
//

 

Caution:
Product is for research use only!

 

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart