pET28a- EGFP


  • Model: PVT0073
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pET28a-EGFP,Plasmid pET28a-EGFP,pET28a-EGFP vector

Bacterial Resistance:Kanamycin
Growth Strain:DH5α
Expression: Bacterial
Use:pET Plasmid

Promoter: T7/lac
Replicator: ColE1, ori, F1, ori
Terminator: T7 Terminator
Plasmid classification: large intestine series plasmid, large intestine fluorescent plasmid, large intestine green plasmid
Plasmid size: 6050bp
Plasmid labels: N-6 * His, N-Thrombin, N-EGFP, C-6 * His
Prokaryotic resistance: kanamycin Kan (50 g/ml)
Clone strain: DH5 alpha and other Escherichia coli
Culture conditions: 37 DEG C, aerobic, LB
Expressing host: BL21 (DE3) and other E. coli
Culture conditions: 37 DEG C, aerobic, LB
Induction: IPTG or lactose and its analogues
Primers for 5'sequencing: T7 (TAATACGACTCACTATAGGG)
Primers for 3'sequencing: T7-ter (TGCTAGTTATTGCTCAGCGG)

pET28a EGFP-1 pasmid


LOCUS       Exported                6050 bp ds-DNA     circular SYN 12-JUL-2017
DEFINITION  synthetic circular DNA
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 6050)
  TITLE     Direct Submission
  JOURNAL   Exported 2015-4-17 
REFERENCE   2  (bases 1 to 6050)
  TITLE     Direct Submission
  JOURNAL   Exported Wednesday, July 12, 2017
FEATURES             Location/Qualifiers
     source          1..6050
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     rep_origin      12..467
                     /note="f1 ori"
                     /note="f1 ori
                     f1 bacteriophage origin of replication; arrow indicates
                     direction of (+) strand synthesis"
     CDS             complement(560..1375)
                     /product="aminoglycoside phosphotransferase"
                     confers resistance to kanamycin in bacteria or G418
                     (Geneticin(R)) in eukaryotes"
     rep_origin      1497..2085
                     high-copy-number ColE1/pMB1/pBR322/pUC origin of
     misc_feature    2271..2413
                     basis of mobility region from pBR322"
     CDS             complement(2515..2706)
                     /product="Rop protein, which maintains plasmids at low copy
     CDS             complement(3515..4597)
                     /product="lac repressor"
                     The lac repressor binds to the lac operator to inhibit
                     transcription in E. coli. This inhibition can be relieved
                     by adding lactose or isopropyl-beta-D-thiogalactopyranoside
     promoter        complement(4598..4675)
                     /note="lacI lacI promoter"
                     /note="lacI promoter"
     promoter        4984..5002
                     /note="T7 promoter"
                     /note="T7 promoter
                     promoter for bacteriophage T7 RNA polymerase"
     CDS             5083..5100
                     /product="6xHis affinity tag"
                     /note="6xHis affinity tag"
     CDS             5131..5847
                     /product="enhanced GFP"
                     /note="enhanced GFP"
                     mammalian codon-optimized"
     misc_feature    5848..5893
     CDS             5894..5911
                     /product="6xHis affinity tag"
                     /note="6xHis affinity tag"

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
