pET28a- SUMO


  • Model: PVT0080
  • 49 Units in Stock
Ask a question

Add to Cart:


PVT0080    2ug


pET28a-SUMO Information

Bacterial Resistance:Kanamycin
Growth Strain:DH5α
Expression: Bacterial
Use:pET Plasmid


Promoter: T7/lac
Replicator: ColE1, ori, F1, ori
Terminator: T7 Terminator
Plasmid classification: Escherichia coli vector, PET series of expressed plasmids
Plasmid size: 5633bp
Plasmid labels: N-6 * His, N-Thrombin, N-SUMO, C-6 * His
Prokaryotic resistance: kanamycin Kan
Clone strain: DH5 alpha
Culture conditions: 37 DEG C, aerobic, LB
Expression host: BL21 (DE3)
Culture conditions: 37 DEG C, aerobic, LB
Induction: IPTG or lactose and its analogues
Primers for 5'sequencing: T7:TAATACGACTCACTATAGGG
Primers for 3'sequencing: T7-ter:TGCTAGTTATTGCTCAGCGG


pET28a-SUMO Squence

LOCUS       Exported                5633 bp ds-DNA     circular SYN 03-8-2015
DEFINITION  synthetic circular DNA
KEYWORDS    Untitled 5
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 5633)
  TITLE     Direct Submission
  JOURNAL   Exported 2015-8-3   
FEATURES             Location/Qualifiers
     source          1..5633
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     source          5042..5064
                     /organism="Enterobacteria phage T7"
                     /mol_type="genomic DNA"
     rep_origin      12..467
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     CDS             complement(560..1375)
                     /product="aminoglycoside phosphotransferase"
                     /note="confers resistance to kanamycin in bacteria or G418
                     (Geneticin(R)) in eukaryotes"
     rep_origin      1497..2085
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     misc_feature    2271..2413
                     /note="basis of mobility region from pBR322"
     CDS             complement(2515..2706)
                     /product="Rop protein, which maintains plasmids at low copy
     CDS             complement(3515..4597)
                     /product="lac repressor"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(4598..4675)
                     /note="lacI promoter"
     promoter        4984..5002
                     /note="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     protein_bind    5003..5027
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     RBS             5042..5064
                     /note="efficient ribosome binding site from bacteriophage
                     T7 gene 10 (Olins and Rangwala, 1989)"
     CDS             5083..5100
                     /product="6xHis affinity tag"
     CDS             5110..5127
                     /product="thrombin recognition and cleavage site"
                     /note="thrombin site"
     CDS             5140..5430
                     /gene="S. cerevisiae SMT3 (truncated)"
                     /product="cleavable ubiquitin-like protein tag"
     CDS             5477..5494
                     /product="6xHis affinity tag"
     terminator      5561..5608
                     /note="T7 terminator"
                     /note="transcription terminator for bacteriophage T7 RNA
        1 tggcgaatgg gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg
       61 cagcgtgacc gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc
      121 ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg
      181 gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc
      241 acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt
      301 ctttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc
      361 ttttgattta taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta
      421 acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaatttcag gtggcacttt
      481 tcggggaaat gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta
      541 tccgctcatg aattaattct tagaaaaact catcgagcat caaatgaaac tgcaatttat
      601 tcatatcagg attatcaata ccatattttt gaaaaagccg tttctgtaat gaaggagaaa
      661 actcaccgag gcagttccat aggatggcaa gatcctggta tcggtctgcg attccgactc
      721 gtccaacatc aatacaacct attaatttcc cctcgtcaaa aataaggtta tcaagtgaga
      781 aatcaccatg agtgacgact gaatccggtg agaatggcaa aagtttatgc atttctttcc
      841 agacttgttc aacaggccag ccattacgct cgtcatcaaa atcactcgca tcaaccaaac
      901 cgttattcat tcgtgattgc gcctgagcga gacgaaatac gcgatcgctg ttaaaaggac
      961 aattacaaac aggaatcgaa tgcaaccggc gcaggaacac tgccagcgca tcaacaatat
     1021 tttcacctga atcaggatat tcttctaata cctggaatgc tgttttcccg gggatcgcag
     1081 tggtgagtaa ccatgcatca tcaggagtac ggataaaatg cttgatggtc ggaagaggca
     1141 taaattccgt cagccagttt agtctgacca tctcatctgt aacatcattg gcaacgctac
     1201 ctttgccatg tttcagaaac aactctggcg catcgggctt cccatacaat cgatagattg
     1261 tcgcacctga ttgcccgaca ttatcgcgag cccatttata cccatataaa tcagcatcca
     1321 tgttggaatt taatcgcggc ctagagcaag acgtttcccg ttgaatatgg ctcataacac
     1381 cccttgtatt actgtttatg taagcagaca gttttattgt tcatgaccaa aatcccttaa
     1441 cgtgagtttt cgttccactg agcgtcagac cccgtagaaa agatcaaagg atcttcttga
     1501 gatccttttt ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc gctaccagcg
     1561 gtggtttgtt tgccggatca agagctacca actctttttc cgaaggtaac tggcttcagc
     1621 agagcgcaga taccaaatac tgtccttcta gtgtagccgt agttaggcca ccacttcaag
     1681 aactctgtag caccgcctac atacctcgct ctgctaatcc tgttaccagt ggctgctgcc
     1741 agtggcgata agtcgtgtct taccgggttg gactcaagac gatagttacc ggataaggcg
     1801 cagcggtcgg gctgaacggg gggttcgtgc acacagccca gcttggagcg aacgacctac
     1861 accgaactga gatacctaca gcgtgagcta tgagaaagcg ccacgcttcc cgaagggaga
     1921 aaggcggaca ggtatccggt aagcggcagg gtcggaacag gagagcgcac gagggagctt
     1981 ccagggggaa acgcctggta tctttatagt cctgtcgggt ttcgccacct ctgacttgag
     2041 cgtcgatttt tgtgatgctc gtcagggggg cggagcctat ggaaaaacgc cagcaacgcg
     2101 gcctttttac ggttcctggc cttttgctgg ccttttgctc acatgttctt tcctgcgtta
     2161 tcccctgatt ctgtggataa ccgtattacc gcctttgagt gagctgatac cgctcgccgc
     2221 agccgaacga ccgagcgcag cgagtcagtg agcgaggaag cggaagagcg cctgatgcgg
     2281 tattttctcc ttacgcatct gtgcggtatt tcacaccgca tatatggtgc actctcagta
     2341 caatctgctc tgatgccgca tagttaagcc agtatacact ccgctatcgc tacgtgactg
     2401 ggtcatggct gcgccccgac acccgccaac acccgctgac gcgccctgac gggcttgtct
     2461 gctcccggca tccgcttaca gacaagctgt gaccgtctcc gggagctgca tgtgtcagag
     2521 gttttcaccg tcatcaccga aacgcgcgag gcagctgcgg taaagctcat cagcgtggtc
     2581 gtgaagcgat tcacagatgt ctgcctgttc atccgcgtcc agctcgttga gtttctccag
     2641 aagcgttaat gtctggcttc tgataaagcg ggccatgtta agggcggttt tttcctgttt
     2701 ggtcactgat gcctccgtgt aagggggatt tctgttcatg ggggtaatga taccgatgaa
     2761 acgagagagg atgctcacga tacgggttac tgatgatgaa catgcccggt tactggaacg
     2821 ttgtgagggt aaacaactgg cggtatggat gcggcgggac cagagaaaaa tcactcaggg
     2881 tcaatgccag cgcttcgtta atacagatgt aggtgttcca cagggtagcc agcagcatcc
     2941 tgcgatgcag atccggaaca taatggtgca gggcgctgac ttccgcgttt ccagacttta
     3001 cgaaacacgg aaaccgaaga ccattcatgt tgttgctcag gtcgcagacg ttttgcagca
     3061 gcagtcgctt cacgttcgct cgcgtatcgg tgattcattc tgctaaccag taaggcaacc
     3121 ccgccagcct agccgggtcc tcaacgacag gagcacgatc atgcgcaccc gtggggccgc
     3181 catgccggcg ataatggcct gcttctcgcc gaaacgtttg gtggcgggac cagtgacgaa
     3241 ggcttgagcg agggcgtgca agattccgaa taccgcaagc gacaggccga tcatcgtcgc
     3301 gctccagcga aagcggtcct cgccgaaaat gacccagagc gctgccggca cctgtcctac
     3361 gagttgcatg ataaagaaga cagtcataag tgcggcgacg atagtcatgc cccgcgccca
     3421 ccggaaggag ctgactgggt tgaaggctct caagggcatc ggtcgagatc ccggtgccta
     3481 atgagtgagc taacttacat taattgcgtt gcgctcactg cccgctttcc agtcgggaaa
     3541 cctgtcgtgc cagctgcatt aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat
     3601 tgggcgccag ggtggttttt cttttcacca gtgagacggg caacagctga ttgcccttca
     3661 ccgcctggcc ctgagagagt tgcagcaagc ggtccacgct ggtttgcccc agcaggcgaa
     3721 aatcctgttt gatggtggtt aacggcggga tataacatga gctgtcttcg gtatcgtcgt
     3781 atcccactac cgagatatcc gcaccaacgc gcagcccgga ctcggtaatg gcgcgcattg
     3841 cgcccagcgc catctgatcg ttggcaacca gcatcgcagt gggaacgatg ccctcattca
     3901 gcatttgcat ggtttgttga aaaccggaca tggcactcca gtcgccttcc cgttccgcta
     3961 tcggctgaat ttgattgcga gtgagatatt tatgccagcc agccagacgc agacgcgccg
     4021 agacagaact taatgggccc gctaacagcg cgatttgctg gtgacccaat gcgaccagat
     4081 gctccacgcc cagtcgcgta ccgtcttcat gggagaaaat aatactgttg atgggtgtct
     4141 ggtcagagac atcaagaaat aacgccggaa cattagtgca ggcagcttcc acagcaatgg
     4201 catcctggtc atccagcgga tagttaatga tcagcccact gacgcgttgc gcgagaagat
     4261 tgtgcaccgc cgctttacag gcttcgacgc cgcttcgttc taccatcgac accaccacgc
     4321 tggcacccag ttgatcggcg cgagatttaa tcgccgcgac aatttgcgac ggcgcgtgca
     4381 gggccagact ggaggtggca acgccaatca gcaacgactg tttgcccgcc agttgttgtg
     4441 ccacgcggtt gggaatgtaa ttcagctccg ccatcgccgc ttccactttt tcccgcgttt
     4501 tcgcagaaac gtggctggcc tggttcacca cgcgggaaac ggtctgataa gagacaccgg
     4561 catactctgc gacatcgtat aacgttactg gtttcacatt caccaccctg aattgactct
     4621 cttccgggcg ctatcatgcc ataccgcgaa aggttttgcg ccattcgatg gtgtccggga
     4681 tctcgacgct ctcccttatg cgactcctgc attaggaagc agcccagtag taggttgagg
     4741 ccgttgagca ccgccgccgc aaggaatggt gcatgcaagg agatggcgcc caacagtccc
     4801 ccggccacgg ggcctgccac catacccacg ccgaaacaag cgctcatgag cccgaagtgg
     4861 cgagcccgat cttccccatc ggtgatgtcg gcgatatagg cgccagcaac cgcacctgtg
     4921 gcgccggtga tgccggccac gatgcgtccg gcgtagagga tcgagatctc gatcccgcga
     4981 aattaatacg actcactata ggggaattgt gagcggataa caattcccct ctagaaataa
     5041 ttttgtttaa ctttaagaag gagatatacc atgggcagca gccatcatca tcatcatcac
     5101 agcagcggcc tggtgccgcg cggcagccat atggctagca tgtcggactc agaagtcaat
     5161 caagaagcta agccagaggt caagccagaa gtcaagcctg agactcacat caatttaaag
     5221 gtgtccgatg gatcttcaga gatcttcttc aagatcaaaa agaccactcc tttaagaagg
     5281 ctgatggaag cgttcgctaa aagacagggt aaggaaatgg actccttaag attcttgtac
     5341 gacggtatta gaattcaagc tgatcagacc cctgaagatt tggacatgga ggataacgat
     5401 attattgagg ctcacagaga acagattggt ggatccgaat tcgagctccg tcgacaagct
     5461 tgcggccgca ctcgagcacc accaccacca ccactgagat ccggctgcta acaaagcccg
     5521 aaaggaagct gagttggctg ctgccaccgc tgagcaataa ctagcataac cccttggggc
     5581 ctctaaacgg gtcttgaggg gttttttgct gaaaggagga actatatccg gat
Product is for research use only!

Search name

pET28a-SUMO,Plasmid pET28a-SUMO,pET28a-SUMO vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
