pET28a- TEV

$293.00

  • Model: PVT10511
  • 50 Units in Stock
Ask a question


Add to Cart:

pET28a-TEV

Catalog No. PVT10511
Packing 2ug

 

pET28a-TEV  Information

Function Protease plasmids

Promoter: T7/lac

Replicator: pUC ori, F1 ori

Terminator: T7-ter

Plasmids: protease expression plasmids

Plasmid label: TEV, His

Prokaryotic resistance: kanamycin Kanamycin

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic, LB

Expression host: Escherichia coli

Culture conditions: 37 centigrade, aerobic, LB

Inducement: IPTG or lactose and its analogues

5'sequencing primers: T7:TAATACGACTCACTATAGGG

3'sequencing primers: T7-ter:TGCTAGTTATTGCTCAGCGG

 

pET28a-TEV Sequence

 


Caution:
Product is for research use only!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart